Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL
· Video Overview · DSSR v2.5.3 (DSSR Manual) · Homepage
-
Hi,
I read the manual, and i am confused, how to start designing the hairpin structure for following sequence.
GGGAGACAAGGAAAATCCTTCAATGAAGTGGGTCTCCC
((((((((((((...)))))...........)))))))
But, I don't know from where to start, i read the manual and found it confusing to start it.
Please suggest tutorial, any help will be very helpful.
Thanks
-
Hi,
Sorry to know that you "read the manual and found it confusing to start" "designing the hairpin structure" of your sequence. That's not a surprise since 3DNA/DSSR is not a tool designed for such modeling purpose. You may find the RNA-Puzzles (http://ahsoka.u-strasbg.fr/rnapuzzlesv2) project relevant: some of the tools reported there should get you started. For example, try RNAComposer (http://rnacomposer.cs.put.poznan.pl).
Best regards,
Xiang-Jun
-
Thankyou for the reply,
I used the server and obtained RNA structure, now I need to modify this structure to DNA, can 3DNA help me to perform this step.
-
Thanks for your follow-up.
3DNA should be of help in modifying an RNA structure into its DNA variant. There are several possibilities here. Please use a concrete example to illustrate what you want to achieve.
Xiang-Jun
Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids
Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University