3DNA Forum

Questions and answers => General discussions (Q&As) => Topic started by: atyagiaa on September 04, 2017, 11:42:05 pm

Title: construct dna hairpin structure
Post by: atyagiaa on September 04, 2017, 11:42:05 pm: Hi,

I read the manual, and i am confused, how to start designing the hairpin structure for following sequence.

GGGAGACAAGGAAAATCCTTCAATGAAGTGGGTCTCCC
((((((((((((...)))))...........)))))))

But, I don't know from where to start, i read the manual and found it confusing to start it.

Please suggest tutorial, any help will be very helpful.

Thanks
Title: Re: construct dna hairpin structure
Post by: xiangjun on September 04, 2017, 11:57:52 pm: Hi,

Sorry to know that you "read the manual and found it confusing to start" "designing the hairpin structure" of your sequence. That's not a surprise since 3DNA/DSSR is not a tool designed for such modeling purpose. You may find the RNA-Puzzles (http://ahsoka.u-strasbg.fr/rnapuzzlesv2) project relevant: some of the tools reported there should get you started. For example, try RNAComposer (http://rnacomposer.cs.put.poznan.pl).

Best regards,

Xiang-Jun
Title: Re: construct dna hairpin structure
Post by: atyagiaa on September 05, 2017, 05:59:50 am: Thankyou for the reply,

I used the server and obtained RNA structure, now I need to modify this structure to DNA, can 3DNA help me to perform this step.
Title: Re: construct dna hairpin structure
Post by: xiangjun on September 05, 2017, 12:02:16 pm: Thanks for your follow-up.

3DNA should be of help in modifying an RNA structure into its DNA variant. There are several possibilities here. Please use a concrete example to illustrate what you want to achieve.

Xiang-Jun