Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.1 (DSSR Manual) · Homepage
x3dna-dssr -i=1msy.pdb -o=1msy.out # 27 nts
x3dna-dssr --input=1msy.pdb --output=1msy.out # as as above
x3dna-dssr -i=1ehz.pdb -o=1ehz.out # tRNA, 76 nts
x3dna-dssr -i=1jj2.pdb -o=1jj2.out # rRNA, 2876 nts
Run: x3dna-dssr -i=1msy.pdb -o=1msy.out --non-pair --u-turn
****************************************************************************
DSSR: a software program for Defining the Secondary
Structures of RNA from three-dimensional coordinates
v1.2.5-2015mar19, Xiang-Jun Lu (xiangjun@x3dna.org)
This program is being actively maintained and developed. As always,
I greatly appreciate your feedback! Please report all DSSR-related
issues on the 3DNA Forum (forum.x3dna.org). I strive to respond
*promptly* to *any questions* posted there.
****************************************************************************
Note: Each nucleotide is identified by model:chainId.name#, where the
'model:' portion is omitted if no model number is available (as
is often the case for x-ray crystal structures in the PDB). So a
common example would be B.A1689, meaning adenosine #1689 on
chain B. One-letter base names for modified nucleotides are put
in lower case (e.g., 'c' for 5MC). For further information about
the output notation, please refer to the DSSR User Manual.
Questions and suggestions are always welcome on the 3DNA Forum.
Command: x3dna-dssr -i=1msy.pdb --u-turn --non-pair -o=1msy.out
Date and time: Thu Mar 19 16:17:25 2015
File name: 1msy.pdb
no. of DNA/RNA chains: 1 [A=27]
no. of nucleotides: 27
no. of atoms: 685
no. of waters: 109
no. of metals: 0
****************************************************************************
List of 13 base pairs
nt1 nt2 bp name Saenger LW DSSR
1 A.U2647 A.G2673 U-G Wobble 28-XXVIII cWW cW-W
2 A.G2648 A.U2672 G-U Wobble 28-XXVIII cWW cW-W
3 A.C2649 A.G2671 C-G WC 19-XIX cWW cW-W
4 A.U2650 A.A2670 U-A WC 20-XX cWW cW-W
5 A.C2651 A.G2669 C-G WC 19-XIX cWW cW-W
6 A.C2652 A.G2668 C-G WC 19-XIX cWW cW-W
7 A.U2653 A.C2667 U-C -- n/a tW. tW-.
8 A.A2654 A.C2666 A+C -- n/a tHH tM+M
9 A.G2655 A.U2656 G+U Platform n/a cSH cm+M
10 A.U2656 A.A2665 U-A rHoogsteen 24-XXIV tWH tW-M
11 A.A2657 A.G2664 A-G Sheared 11-XI tHS tM-m
12 A.C2658 A.G2663 C-G WC 19-XIX cWW cW-W
13 A.G2659 A.A2662 G-A Sheared 11-XI tSH tm-M
****************************************************************************
List of 1 multiplet
1 nts=3 GUA A.G2655,A.U2656,A.A2665
****************************************************************************
List of 1 helix
Note: a helix is defined by base-stacking interactions, regardless of bp
type and backbone connectivity, and may contain more than one stem.
helix#number[stems-contained] bps=number-of-base-pairs in the helix
bp-type: '|' for a canonical WC/wobble pair, '.' otherwise
helix-form: classification of a dinucleotide step comprising the bp
above the given designation and the bp that follows it. Types
include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices,
'.' for an unclassified step, and 'x' for a step without a
continuous backbone.
--------------------------------------------------------------------
helix#1[1] bps=12
strand-1 5'-UGCUCCUAUACG-3'
bp-type ||||||....|.
strand-2 3'-GUGAGGCCAGGA-5'
helix-form ..AAA..x...
1 A.U2647 A.G2673 U-G Wobble 28-XXVIII cWW cW-W
2 A.G2648 A.U2672 G-U Wobble 28-XXVIII cWW cW-W
3 A.C2649 A.G2671 C-G WC 19-XIX cWW cW-W
4 A.U2650 A.A2670 U-A WC 20-XX cWW cW-W
5 A.C2651 A.G2669 C-G WC 19-XIX cWW cW-W
6 A.C2652 A.G2668 C-G WC 19-XIX cWW cW-W
7 A.U2653 A.C2667 U-C -- n/a tW. tW-.
8 A.A2654 A.C2666 A+C -- n/a tHH tM+M
9 A.U2656 A.A2665 U-A rHoogsteen 24-XXIV tWH tW-M
10 A.A2657 A.G2664 A-G Sheared 11-XI tHS tM-m
11 A.C2658 A.G2663 C-G WC 19-XIX cWW cW-W
12 A.G2659 A.A2662 G-A Sheared 11-XI tSH tm-M
****************************************************************************
List of 1 stem
Note: a stem is defined as a helix consisting of only canonical WC/wobble
pairs, with a continuous backbone.
stem#number[#helix-number containing this stem]
Other terms are defined as in the above Helix section.
--------------------------------------------------------------------
stem#1[#1] bps=6
strand-1 5'-UGCUCC-3'
bp-type ||||||
strand-2 3'-GUGAGG-5'
helix-form ..AAA
1 A.U2647 A.G2673 U-G Wobble 28-XXVIII cWW cW-W
2 A.G2648 A.U2672 G-U Wobble 28-XXVIII cWW cW-W
3 A.C2649 A.G2671 C-G WC 19-XIX cWW cW-W
4 A.U2650 A.A2670 U-A WC 20-XX cWW cW-W
5 A.C2651 A.G2669 C-G WC 19-XIX cWW cW-W
6 A.C2652 A.G2668 C-G WC 19-XIX cWW cW-W
****************************************************************************
List of 1 isolated WC/wobble pair
Note: isolated WC/wobble pairs are assigned negative indices to
differentiate them from the stem numbers, which are positive.
--------------------------------------------------------------------
[#1] -1 A.C2658 A.G2663 C-G WC 19-XIX cWW cW-W
****************************************************************************
List of 30 non-pairing interactions
1 A.U2647 A.G2648 stacking: 1.0(0.5)--pm(>>,forward)
2 A.G2648 A.C2649 stacking: 7.3(4.6)--pm(>>,forward)
3 A.G2648 A.G2673 stacking: 2.0(0.2)--mm(<>,outward)
4 A.C2649 A.U2650 stacking: 2.8(1.1)--pm(>>,forward)
5 A.U2650 A.C2651 stacking: 0.6(0.0)--pm(>>,forward)
6 A.C2651 A.C2652 stacking: 0.5(0.1)--pm(>>,forward)
7 A.C2652 A.U2653 stacking: 5.2(2.6)--pm(>>,forward)
8 A.C2652 A.G2669 stacking: 0.2(0.0)--mm(<>,outward)
9 A.U2653 A.A2654 stacking: 3.3(2.0)--pp(><,inward) H-bonds[1]: "OP2-O2'(hydroxyl)[2.62]"
10 A.A2654 A.U2656 stacking: 3.7(1.1)--mm(<>,outward) H-bonds[1]: "O4'*O4'[3.05]"
11 A.G2655 A.G2664 stacking: 4.4(2.2)--pp(><,inward) H-bonds[1]: "O2'(hydroxyl)-O6(carbonyl)[3.09]"
12 A.G2655 A.A2665 H-bonds[3]: "N1(imino)-OP2[2.77],N2(amino)-OP2[3.34],N2(amino)-O5'[2.89]"
13 A.U2656 A.G2664 H-bonds[2]: "OP2-N1(imino)[3.04],OP2-N2(amino)[2.94]"
14 A.A2657 A.C2658 stacking: 6.7(2.6)--pm(>>,forward)
15 A.A2657 A.A2665 stacking: 3.7(3.3)--mm(<>,outward)
16 A.C2658 A.G2659 stacking: 0.4(0.1)--pm(>>,forward)
17 A.G2659 A.A2661 H-bonds[1]: "O2'(hydroxyl)-N7[2.60]"
18 A.G2659 A.G2663 stacking: 3.9(1.2)--mm(<>,outward)
19 A.U2660 A.A2661 stacking: 7.5(4.2)--pm(>>,forward)
20 A.A2661 A.A2662 stacking: 6.3(4.4)--pm(>>,forward)
21 A.G2663 A.G2664 stacking: 2.7(0.6)--pm(>>,forward)
22 A.G2664 A.A2665 H-bonds[1]: "O2'(hydroxyl)-O4'[2.75]"
23 A.A2665 A.C2666 stacking: 1.6(1.1)--pm(>>,forward)
24 A.C2666 A.C2667 stacking: 4.3(2.1)--pm(>>,forward)
25 A.C2667 A.G2668 stacking: 3.1(1.0)--pm(>>,forward)
26 A.G2668 A.G2669 stacking: 4.3(3.0)--pm(>>,forward)
27 A.G2669 A.A2670 stacking: 4.3(2.9)--pm(>>,forward)
28 A.A2670 A.G2671 stacking: 1.5(1.5)--pm(>>,forward)
29 A.G2671 A.U2672 stacking: 7.4(4.0)--pm(>>,forward)
30 A.U2672 A.G2673 H-bonds[1]: "O2'(hydroxyl)-O4'[3.37]"
****************************************************************************
List of 4 stacks
Note: a stack is an ordered list of nucleotides assembled together via
base-stacking interactions, regardless of backbone connectivity.
Stacking interactions within a stem are *not* included.
--------------------------------------------------------------------
1 nts=3 UAA A.U2660,A.A2661,A.A2662
2 nts=4 CUAU A.C2652,A.U2653,A.A2654,A.U2656
3 nts=4 GGGG A.G2655,A.G2664,A.G2663,A.G2659
4 nts=6 CAACCG A.C2658,A.A2657,A.A2665,A.C2666,A.C2667,A.G2668
****************************************************************************
Note: for the various types of loops listed below, numbers within the first
set of brackets are the number of loop nts, and numbers in the second
set of brackets are the identities of the stems (positive number) or
isolated WC/wobble pairs (negative numbers) to which they are linked.
****************************************************************************
List of 1 hairpin loop
1 hairpin loop: nts=6; [4]; linked by [#-1]
nts=6 CGUAAG A.C2658,A.G2659,A.U2660,A.A2661,A.A2662,A.G2663
nts=4 GUAA A.G2659,A.U2660,A.A2661,A.A2662
****************************************************************************
List of 1 internal loop
1 asymmetric internal loop: nts=13; [5,4]; linked by [#1,#-1]
nts=13 CUAGUACGGACCG A.C2652,A.U2653,A.A2654,A.G2655,A.U2656,A.A2657,A.C2658,A.G2663,A.G2664,A.A2665,A.C2666,A.C2667,A.G2668
nts=5 UAGUA A.U2653,A.A2654,A.G2655,A.U2656,A.A2657
nts=4 GACC A.G2664,A.A2665,A.C2666,A.C2667
****************************************************************************
List of 1 U-turn
1 A.G2659-A.A2662 H-bonds[2]: "N2(amino)-OP2[2.97],N2(amino)-N7[2.86]" nts=6 CGUAAG A.C2658,A.G2659,A.U2660,A.A2661,A.A2662,A.G2663
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1msy nts=27 [whole]
UGCUCCUAGUACGUAAGGACCGGAGUG
((((((.....(....)....))))))
>1msy-A #1 nts=27 [chain] RNA
UGCUCCUAGUACGUAAGGACCGGAGUG
((((((.....(....)....))))))
****************************************************************************
List of 12 additional files
1 dssr-stems.pdb -- an ensemble of stems
2 dssr-helices.pdb -- an ensemble of helices (coaxial stacking)
3 dssr-pairs.pdb -- an ensemble of base pairs
4 dssr-multiplets.pdb -- an ensemble of multiplets
5 dssr-hairpins.pdb -- an ensemble of hairpin loops
6 dssr-iloops.pdb -- an ensemble of internal loops
7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format
8 dssr-2ndstrs.ct -- secondary structure in connect table format
9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation
10 dssr-torsions.txt -- backbone torsion angles and suite names
11 dssr-Uturns.pdb -- an ensemble of U-turn motifs
12 dssr-stacks.pdb -- an ensemble of stacks
Run: x3dna-dssr -i=1ehz.pdb -o=1ehz.out --po4 --u-turn
****************************************************************************
DSSR: a software program for Defining the Secondary
Structures of RNA from three-dimensional coordinates
v1.2.5-2015mar19, Xiang-Jun Lu (xiangjun@x3dna.org)
This program is being actively maintained and developed. As always,
I greatly appreciate your feedback! Please report all DSSR-related
issues on the 3DNA Forum (forum.x3dna.org). I strive to respond
*promptly* to *any questions* posted there.
****************************************************************************
Note: Each nucleotide is identified by model:chainId.name#, where the
'model:' portion is omitted if no model number is available (as
is often the case for x-ray crystal structures in the PDB). So a
common example would be B.A1689, meaning adenosine #1689 on
chain B. One-letter base names for modified nucleotides are put
in lower case (e.g., 'c' for 5MC). For further information about
the output notation, please refer to the DSSR User Manual.
Questions and suggestions are always welcome on the 3DNA Forum.
Command: x3dna-dssr -i=1ehz.pdb --u-turn --po4 -o=1ehz.out
Date and time: Thu Mar 19 16:17:25 2015
File name: 1ehz.pdb
no. of DNA/RNA chains: 1 [A=76]
no. of nucleotides: 76
no. of atoms: 1821
no. of waters: 160
no. of metals: 9 [Mg=6,Mn=3]
****************************************************************************
List of 11 types of 14 modified nucleotides
nt count list
1 1MA-a 1 A.1MA58
2 2MG-g 1 A.2MG10
3 5MC-c 2 A.5MC40,A.5MC49
4 5MU-t 1 A.5MU54
5 7MG-g 1 A.7MG46
6 H2U-u 2 A.H2U16,A.H2U17
7 M2G-g 1 A.M2G26
8 OMC-c 1 A.OMC32
9 OMG-g 1 A.OMG34
10 PSU-P 2 A.PSU39,A.PSU55
11 YYG-g 1 A.YYG37
****************************************************************************
List of 34 base pairs
nt1 nt2 bp name Saenger LW DSSR
1 A.G1 A.C72 G-C WC 19-XIX cWW cW-W
2 A.C2 A.G71 C-G WC 19-XIX cWW cW-W
3 A.G3 A.C70 G-C WC 19-XIX cWW cW-W
4 A.G4 A.U69 G-U Wobble 28-XXVIII cWW cW-W
5 A.A5 A.U68 A-U WC 20-XX cWW cW-W
6 A.U6 A.A67 U-A WC 20-XX cWW cW-W
7 A.U7 A.A66 U-A WC 20-XX cWW cW-W
8 A.U8 A.A14 U-A rHoogsteen 24-XXIV tWH tW-M
9 A.U8 A.A21 U+A -- n/a tSW tm+W
10 A.A9 A.A23 A+A -- 02-II tHH tM+M
11 A.2MG10 A.C25 g-C WC 19-XIX cWW cW-W
12 A.2MG10 A.G45 g+G -- n/a cHS cM+m
13 A.C11 A.G24 C-G WC 19-XIX cWW cW-W
14 A.U12 A.A23 U-A WC 20-XX cWW cW-W
15 A.C13 A.G22 C-G WC 19-XIX cWW cW-W
16 A.G15 A.C48 G+C rWC 22-XXII tWW tW+W
17 A.H2U16 A.U59 u+U -- n/a tSW tm+W
18 A.G18 A.PSU55 G+P -- n/a tWS tW+m
19 A.G19 A.C56 G-C WC 19-XIX cWW cW-W
20 A.G22 A.7MG46 G-g -- 07-VII tHW tM-W
21 A.M2G26 A.A44 g-A Imino 08-VIII cWW cW-W
22 A.C27 A.G43 C-G WC 19-XIX cWW cW-W
23 A.C28 A.G42 C-G WC 19-XIX cWW cW-W
24 A.A29 A.U41 A-U WC 20-XX cWW cW-W
25 A.G30 A.5MC40 G-c WC 19-XIX cWW cW-W
26 A.A31 A.PSU39 A-P -- n/a cWW cW-W
27 A.OMC32 A.A38 c-A -- n/a c.W c.-W
28 A.U33 A.A36 U-A -- n/a tSH tm-M
29 A.5MC49 A.G65 c-G WC 19-XIX cWW cW-W
30 A.U50 A.A64 U-A WC 20-XX cWW cW-W
31 A.G51 A.C63 G-C WC 19-XIX cWW cW-W
32 A.U52 A.A62 U-A WC 20-XX cWW cW-W
33 A.G53 A.C61 G-C WC 19-XIX cWW cW-W
34 A.5MU54 A.1MA58 t-a rHoogsteen 24-XXIV tWH tW-M
****************************************************************************
List of 4 multiplets
1 nts=3 UAA A.U8,A.A14,A.A21
2 nts=3 AUA A.A9,A.U12,A.A23
3 nts=3 gCG A.2MG10,A.C25,A.G45
4 nts=3 CGg A.C13,A.G22,A.7MG46
****************************************************************************
List of 2 helices
Note: a helix is defined by base-stacking interactions, regardless of bp
type and backbone connectivity, and may contain more than one stem.
helix#number[stems-contained] bps=number-of-base-pairs in the helix
bp-type: '|' for a canonical WC/wobble pair, '.' otherwise
helix-form: classification of a dinucleotide step comprising the bp
above the given designation and the bp that follows it. Types
include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices,
'.' for an unclassified step, and 'x' for a step without a
continuous backbone.
--------------------------------------------------------------------
helix#1[2] bps=15
strand-1 5'-GCGGAUUcUGUGtPC-3'
bp-type ||||||||||||..|
strand-2 3'-CGCUUAAGACACaGG-5'
helix-form AA....xAAAAxx.
1 A.G1 A.C72 G-C WC 19-XIX cWW cW-W
2 A.C2 A.G71 C-G WC 19-XIX cWW cW-W
3 A.G3 A.C70 G-C WC 19-XIX cWW cW-W
4 A.G4 A.U69 G-U Wobble 28-XXVIII cWW cW-W
5 A.A5 A.U68 A-U WC 20-XX cWW cW-W
6 A.U6 A.A67 U-A WC 20-XX cWW cW-W
7 A.U7 A.A66 U-A WC 20-XX cWW cW-W
8 A.5MC49 A.G65 c-G WC 19-XIX cWW cW-W
9 A.U50 A.A64 U-A WC 20-XX cWW cW-W
10 A.G51 A.C63 G-C WC 19-XIX cWW cW-W
11 A.U52 A.A62 U-A WC 20-XX cWW cW-W
12 A.G53 A.C61 G-C WC 19-XIX cWW cW-W
13 A.5MU54 A.1MA58 t-a rHoogsteen 24-XXIV tWH tW-M
14 A.PSU55 A.G18 P+G -- n/a tSW tm+W
15 A.C56 A.G19 C-G WC 19-XIX cWW cW-W
--------------------------------------------------------------------------
helix#2[2] bps=15
strand-1 5'-AAPcUGGAgCUCAGu-3'
bp-type ...||||.||||...
strand-2 3'-UcAGACCgCGAGUCU-5'
helix-form x..AAAAxAA.xxx
1 A.A36 A.U33 A-U -- n/a tHS tM-m
2 A.A38 A.OMC32 A-c -- n/a cW. cW-.
3 A.PSU39 A.A31 P-A -- n/a cWW cW-W
4 A.5MC40 A.G30 c-G WC 19-XIX cWW cW-W
5 A.U41 A.A29 U-A WC 20-XX cWW cW-W
6 A.G42 A.C28 G-C WC 19-XIX cWW cW-W
7 A.G43 A.C27 G-C WC 19-XIX cWW cW-W
8 A.A44 A.M2G26 A-g Imino 08-VIII cWW cW-W
9 A.2MG10 A.C25 g-C WC 19-XIX cWW cW-W
10 A.C11 A.G24 C-G WC 19-XIX cWW cW-W
11 A.U12 A.A23 U-A WC 20-XX cWW cW-W
12 A.C13 A.G22 C-G WC 19-XIX cWW cW-W
13 A.A14 A.U8 A-U rHoogsteen 24-XXIV tHW tM-W
14 A.G15 A.C48 G+C rWC 22-XXII tWW tW+W
15 A.H2U16 A.U59 u+U -- n/a tSW tm+W
****************************************************************************
List of 4 stems
Note: a stem is defined as a helix consisting of only canonical WC/wobble
pairs, with a continuous backbone.
stem#number[#helix-number containing this stem]
Other terms are defined as in the above Helix section.
--------------------------------------------------------------------
stem#1[#1] bps=7
strand-1 5'-GCGGAUU-3'
bp-type |||||||
strand-2 3'-CGCUUAA-5'
helix-form AA....
1 A.G1 A.C72 G-C WC 19-XIX cWW cW-W
2 A.C2 A.G71 C-G WC 19-XIX cWW cW-W
3 A.G3 A.C70 G-C WC 19-XIX cWW cW-W
4 A.G4 A.U69 G-U Wobble 28-XXVIII cWW cW-W
5 A.A5 A.U68 A-U WC 20-XX cWW cW-W
6 A.U6 A.A67 U-A WC 20-XX cWW cW-W
7 A.U7 A.A66 U-A WC 20-XX cWW cW-W
--------------------------------------------------------------------------
stem#2[#2] bps=4
strand-1 5'-gCUC-3'
bp-type ||||
strand-2 3'-CGAG-5'
helix-form AA.
1 A.2MG10 A.C25 g-C WC 19-XIX cWW cW-W
2 A.C11 A.G24 C-G WC 19-XIX cWW cW-W
3 A.U12 A.A23 U-A WC 20-XX cWW cW-W
4 A.C13 A.G22 C-G WC 19-XIX cWW cW-W
--------------------------------------------------------------------------
stem#3[#2] bps=4
strand-1 5'-CCAG-3'
bp-type ||||
strand-2 3'-GGUc-5'
helix-form AAA
1 A.C27 A.G43 C-G WC 19-XIX cWW cW-W
2 A.C28 A.G42 C-G WC 19-XIX cWW cW-W
3 A.A29 A.U41 A-U WC 20-XX cWW cW-W
4 A.G30 A.5MC40 G-c WC 19-XIX cWW cW-W
--------------------------------------------------------------------------
stem#4[#1] bps=5
strand-1 5'-cUGUG-3'
bp-type |||||
strand-2 3'-GACAC-5'
helix-form AAAA
1 A.5MC49 A.G65 c-G WC 19-XIX cWW cW-W
2 A.U50 A.A64 U-A WC 20-XX cWW cW-W
3 A.G51 A.C63 G-C WC 19-XIX cWW cW-W
4 A.U52 A.A62 U-A WC 20-XX cWW cW-W
5 A.G53 A.C61 G-C WC 19-XIX cWW cW-W
****************************************************************************
List of 1 isolated WC/wobble pair
Note: isolated WC/wobble pairs are assigned negative indices to
differentiate them from the stem numbers, which are positive.
--------------------------------------------------------------------
[#1] -1 A.G19 A.C56 G-C WC 19-XIX cWW cW-W
****************************************************************************
List of 2 coaxial stacks
1 Helix#1 contains 2 stems: [#1,#4]
2 Helix#2 contains 2 stems: [#3,#2]
****************************************************************************
List of 11 stacks
Note: a stack is an ordered list of nucleotides assembled together via
base-stacking interactions, regardless of backbone connectivity.
Stacking interactions within a stem are *not* included.
--------------------------------------------------------------------
1 nts=2 Uc A.U7,A.5MC49
2 nts=2 UC A.U8,A.C13
3 nts=2 GA A.G65,A.A66
4 nts=3 CgC A.C25,A.M2G26,A.C27
5 nts=3 gAC A.7MG46,A.A21,A.C48
6 nts=3 GtP A.G53,A.5MU54,A.PSU55
7 nts=4 GACC A.G1,A.A73,A.C74,A.C75
8 nts=4 GAcU A.G30,A.A31,A.OMC32,A.U33
9 nts=5 GGGaC A.G19,A.G57,A.G18,A.1MA58,A.C61
10 nts=7 gAAgAPc A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39,A.5MC40
11 nts=9 GAGAGAGUC A.G43,A.A44,A.G45,A.A9,A.G22,A.A14,A.G15,A.U59,A.C60
-----------------------------------------------------------------------
Nucleotides not involved in stacking interactions
nts=4 uGUA A.H2U17,A.G20,A.U47,A.A76
****************************************************************************
Note: for the various types of loops listed below, numbers within the first
set of brackets are the number of loop nts, and numbers in the second
set of brackets are the identities of the stems (positive number) or
isolated WC/wobble pairs (negative numbers) to which they are linked.
****************************************************************************
List of 3 hairpin loops
1 hairpin loop: nts=10; [8]; linked by [#2]
nts=10 CAGuuGGGAG A.C13,A.A14,A.G15,A.H2U16,A.H2U17,A.G18,A.G19,A.G20,A.A21,A.G22
nts=8 AGuuGGGA A.A14,A.G15,A.H2U16,A.H2U17,A.G18,A.G19,A.G20,A.A21
2 hairpin loop: nts=11; [9]; linked by [#3]
nts=11 GAcUgAAgAPc A.G30,A.A31,A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39,A.5MC40
nts=9 AcUgAAgAP A.A31,A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37,A.A38,A.PSU39
3 hairpin loop: nts=9; [7]; linked by [#4]
nts=9 GtPCGaUCC A.G53,A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59,A.C60,A.C61
nts=7 tPCGaUC A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59,A.C60
****************************************************************************
List of 1 junction
1 4-way junction: nts=16; [2,1,5,0]; linked by [#1,#2,#3,#4]
nts=16 UUAgCgCGAGgUCcGA A.U7,A.U8,A.A9,A.2MG10,A.C25,A.M2G26,A.C27,A.G43,A.A44,A.G45,A.7MG46,A.U47,A.C48,A.5MC49,A.G65,A.A66
nts=2 UA A.U8,A.A9
nts=1 g A.M2G26
nts=5 AGgUC A.A44,A.G45,A.7MG46,A.U47,A.C48
nts=0
****************************************************************************
List of 1 non-loop single-stranded segment
1 nts=4 ACCA A.A73,A.C74,A.C75,A.A76
****************************************************************************
List of 1 kissing loop interaction
1 isolated-pair #-1 between hairpin loops #1 and #3
****************************************************************************
List of 2 U-turns
1 A.U33-A.A36 H-bonds[1]: "N3(imino)-OP2[2.80]" nts=6 cUgAAg A.OMC32,A.U33,A.OMG34,A.A35,A.A36,A.YYG37
2 A.PSU55-A.1MA58 H-bonds[1]: "N3-OP2[2.77]" nts=6 tPCGaU A.5MU54,A.PSU55,A.C56,A.G57,A.1MA58,A.U59
****************************************************************************
List of 18 phosphate interactions
1 A.U7 OP1-hbonds[1]: "MG@A.MG580[2.60]"
2 A.A9 OP2-hbonds[1]: "N4@A.C13[3.01]"
3 A.A14 OP2-hbonds[1]: "MG@A.MG580[1.93]"
4 A.H2U16 OP2-cap: "A.H2U16"
5 A.G18 OP1-hbonds[1]: "O2'@A.H2U17[2.97]"
6 A.G19 OP1-hbonds[2]: "N4@A.C60[3.27],MN@A.MN530[2.19]"
7 A.G20 OP1-hbonds[1]: "MG@A.MG540[2.07]"
8 A.A21 OP2-hbonds[1]: "MG@A.MG540[2.11]"
9 A.A23 OP2-hbonds[1]: "N6@A.A9[3.12]"
10 A.A35 OP2-cap: "A.U33"
11 A.A36 OP2-hbonds[1]: "N3@A.U33[2.80]"
12 A.YYG37 OP2-hbonds[1]: "MG@A.MG590[2.53]"
13 A.C48 OP2-hbonds[1]: "O2'@A.7MG46[3.55]"
14 A.5MC49 OP1-hbonds[1]: "O2'@A.C48[3.13]" OP2-hbonds[1]: "O2'@A.U7[2.68]"
15 A.U50 OP1-hbonds[1]: "O2'@A.U47[2.71]"
16 A.G57 OP2-cap: "A.PSU55"
17 A.1MA58 OP2-hbonds[1]: "N3@A.PSU55[2.77]"
18 A.C60 OP1-hbonds[1]: "N4@A.C61[3.12]" OP2-hbonds[1]: "O2'@A.1MA58[2.42]"
****************************************************************************
This structure contains 1-order pseudoknot
o You may want to run DSSR again with the '--nested' option which removes
pseudoknots to get a fully nested secondary structure representation.
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>1ehz nts=76 [whole]
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGtPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....
>1ehz-A #1 nts=76 [chain] RNA
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGtPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....
****************************************************************************
List of 12 additional files
1 dssr-stems.pdb -- an ensemble of stems
2 dssr-helices.pdb -- an ensemble of helices (coaxial stacking)
3 dssr-pairs.pdb -- an ensemble of base pairs
4 dssr-multiplets.pdb -- an ensemble of multiplets
5 dssr-hairpins.pdb -- an ensemble of hairpin loops
6 dssr-junctions.pdb -- an ensemble of junctions (multi-branch)
7 dssr-2ndstrs.bpseq -- secondary structure in bpseq format
8 dssr-2ndstrs.ct -- secondary structure in connect table format
9 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation
10 dssr-torsions.txt -- backbone torsion angles and suite names
11 dssr-Uturns.pdb -- an ensemble of U-turn motifs
12 dssr-stacks.pdb -- an ensemble of stacks
>1msy-A #1 RNA with 27 nts
UGCUCCUAGUACGUAAGGACCGGAGUG
.(((((.....(....)....))))).
>1ehz-A #1 RNA with 76 nts
GCGGAUUUAgCUCAGuuGGGAGAGCgCCAGAcUgAAgAPcUGGAGgUCcUGUGuPCGaUCCACAGAAUUCGCACCA
(((((((..((((.....[..)))).((((.........)))).....(((((..]....))))))))))))....
Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids
Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University