Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL
· Video Overview · DSSR v2.8.1 (DSSR Manual) · Homepage
· HIRING!
-
Hello everyone,
I want to generate the DNA Triple Helix. So I docked Double Helix DNA with Single Stranded DNA.
But, the ssDNA show intramolecular bonding(backbone and nitrogen bases) which is un-usual.
Most of the softwares are based on the energy functions.
Can we ignore those bonds ?
Why DNA-DNA docking is not possible for larger size DNA(ligand)?
Is there any rotational bond limitations for DNA-DNA docking?
Any help or suggestions would be greatly appreciated.
Thanks
Himanshu
-
Hi Himanshu,
Thanks for posting at the 3DNA forum. Just to be clear, 3DNA does not perform DNA-DNA docking or any energy calculations.
But, the ssDNA show intramolecular bonding(backbone and nitrogen bases) which is un-usual.
Could you elaborate on it? Better with a specific example.
However, 3DNA does provide the following approach for DNA triplex creation which may be useful to your project:
- Build a fiber model (e.g., #31) for Poly (U) : poly (A) : poly(U) (11-fold). Type "[mono:26cqmn7j]fiber -m[/mono:26cqmn7j]" for more info, and search the forum for related posts. Alternatively (or better), pick a related triplex structure from the PDB, or another source.
- Perform base mutations (using [mono:26cqmn7j][red:26cqmn7j]mutate_bases[/red:26cqmn7j][/mono:26cqmn7j]) to your specific sequence. See thread "change one base pair in a double-strand DNA structure file (http://http://3dna.rutgers.edu:8080/forum/viewtopic.php?f=1&t=210#p632)".
Please note that the mutated triplexes may have steric clashes (atoms too close) or longer than ideal H-bonding geometry: they are intended as initial structures for refinement using any of the available energy calculation tools.
HTH,
Xiang-Jun
-
Hello Xiang-Jun,
Gland to see the immediate reply.
"the ssDNA show intramolecular bonding(backbone and nitrogen bases) which is un-usual"
In the helix of DNA there should not be any bond between the backbone of the DNA and the nitrogen base which is attached to the backbone.
Fig1.png(as attachment) : white ribbon shows Double Helix DNA which target for the docking;
green ribbon shows single strand DNA which is ligand to dock in double stranded DNA. In the green ribbon there is intra-molecular bonding.
Can we ignore those bonds?
thank you.
Himanshu
-
Hi Himanshu,
Fig1.png(as attachment) : ... green ribbon shows single strand DNA which is ligand to dock in double stranded DNA. In the green ribbon there is intra-molecular bonding.
Thanks for attaching a PNG image illustrating the unusual "intramolecular bonding(backbone and nitrogen bases)". It is certainly clearer than pure text description. However, it would be even better if you provide the corresponding PDB file so others can easily visualize the problematic structure.
Can we ignore those bonds?
I do not know how you generated the structure, and for what purpose, thus I cannot offer any advice in this regard. The question appears not to be directly 3DNA-related. However, the image does show that the ssDNA is in poor geometry.
Xiang-Jun
-
Hello Xiang-Jun,
thanks for immediate reply.
I have taken three DNA strands one double helix, and one single stranded DNA.
->1st strand of Double helix
5' CCCGAGAGAGAGGGCGGACAGGAC 3'
->complementry strand of 1st strand of double helix
5' GTCCTGTCCGCCCTCTCTCTCGGG 3'
-> 3rd single strand
5' GAGAGGGGGGAGAGAGAG 3’
to form triple helix I have to dock 3rd single strand(took as ligand) with the double helix(took as receptor) then I would get the triple helix DNA. This is my assumption.
Problem:
1. DNA-DNA docking is not possible for the larger single strand DNA(taken as ligand). Can you tell why?
2. So I take 3rd single strand just of 3 base-pairs only (GAG) then also it is showing intra-molecular bond between the backbone of the ss-DNA and Nitrogenous bases. But according to the literature there should not be any bond between back-bone of DNA and its own Nitrogenous base, which is shown in the figure.
3. We do simulation that is mainly based on the potential energy. If we ignore these bonds, It would not affect the result efficiency?
4. If my assumption is wrong? Then what should be the idea to form DNA Triple Helix?
Thank you.
Himanshu
-
Hi Himanshu,
I know English is not my native language, but do you really have any problem in understanding my previous two replies to your questions in the thread?
I wish 3DNA could be helpful to your project. However, 3DNA has been designed for some specific purposes, and apparently it does not fit your need. Please check some other (docking) software, e.g., HADDOCK (http://http://www.nmr.chem.uu.nl/haddock/) from Alexandre Bonvin. Good luck!
Xiang-Jun
Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids
Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University