Netiquette · Download · News · Gallery · G-quadruplexes · DSSR-Jmol · DSSR-PyMOL · Video Overview · DSSR v2.9.1 (DSSR Manual) · Homepage
DSSR: an Integrated Software Tool for
Dissecting the Spatial Structure of RNA
v2.4.2-2023may01 by xiangjun@x3dna.org
...
****************************************************************************
List of 8 base pairs
nt1 nt2 bp name Saenger LW DSSR
1 A.G1 A.C21 G-C WC 19-XIX cWW cW-W
2 A.G2 A.C20 G-C WC 19-XIX cWW cW-W
3 A.C3 A.G19 C-G WC 19-XIX cWW cW-W
4 A.G4 A.U18 G-U Wobble 28-XXVIII cWW cW-W
5 A.U5 A.A17 U-A WC 20-XX cWW cW-W
6 A.A7 A.U16 A-U -- -- cWW cW-W
7 A.G8 A.C15 G-C WC 19-XIX cWW cW-W
8 A.G9 A.C14 G-C WC 19-XIX cWW cW-W
****************************************************************************
...
****************************************************************************
Secondary structures in dot-bracket notation (dbn) as a whole and per chain
>17RA nts=21 [whole]
GGCGUAAGGAUUACCUAUGCC
(((((..((....)).)))))
****************************************************************************
...
17 R.G19 R.C49 G-C WC 19-XIX cWW cW-W
[-155.1(anti) ~C3'-endo lambda=50.2] [-106.9(anti) ~C2'-endo lambda=53.7]
d(C1'-C1')=10.82 d(N1-N9)=9.00 d(C6-C8)=9.90 tor(C1'-N1-N9-C1')=-11.0
H-bonds[3]: "O6(carbonyl)-N4(amino)[2.93],N1(imino)-N3[2.91],N2(amino)-O2(carbonyl)[2.81]"
interBase-angle=8 Simple-bpParams: Shear=-0.21 Stretch=-0.13 Buckle=-2.1 Propeller=-7.6
...
# x3dna-dssr -i=8SH5.pdb
stem#3[#2, #3]* bps=2 parallel
strand-1 5'-GG-3'
bp-type ||
strand-2 5'-CC-3'
helix-form .
1 R.G19 R.C49 G-C WC 19-XIX cWW cW-W
2 R.G20 R.C50 G-C WC 19-XIX cWW cW-W
Funded by the NIH R24GM153869 grant on X3DNA-DSSR, an NIGMS National Resource for Structural Bioinformatics of Nucleic Acids
Created and maintained by Dr. Xiang-Jun Lu, Department of Biological Sciences, Columbia University