**************************************************************************** DSSR: an Integrated Software Tool for Dissecting the Spatial Structure of RNA v2.4.2-2023may01 by xiangjun@x3dna.org **************************************************************************** Note: By default, each nucleotide is identified by chainId.name#. So a common case would be B.A1689, meaning adenosine #1689 on chain B. One-letter base names for modified nucleotides are put in lower case (e.g., 'c' for 5MC). For further information about the output notation, please refer to the DSSR User Manual. Questions and suggestions are *always* welcome on the 3DNA Forum. Command: x3dna-dssr -i=RNA.pdb -o=RNA.out Date and time: Thu Aug 8 19:24:47 2024 File name: RNA.pdb no. of DNA/RNA chains: 1 [A=346] no. of nucleotides: 346 no. of atoms: 7461 no. of waters: 0 no. of metals: 0 **************************************************************************** List of 170 base pairs nt1 nt2 bp name Saenger LW DSSR 1 A.A563 A.U884 A+U rWC 21-XXI tWW tW+W 2 A.G567 A.C883 G-C WC 19-XIX cWW cW-W 3 A.G568 A.A574 G+A Linker -- tSS tm+m 4 A.G568 A.C882 G-C WC 19-XIX cWW cW-W 5 A.C569 A.G881 C-G WC 19-XIX cWW cW-W 6 A.G570 A.C866 G-C WC 19-XIX cWW cW-W 7 A.U571 A.A865 U-A WC 20-XX cWW cW-W 8 A.A572 A.A574 A-A -- -- cHH cM-M 9 A.A573 A.C883 A-C -- -- cSS cm-m 10 A.G575 A.G576 G+G Platform -- cSH cm+M 11 A.G575 A.C880 G-C WC 19-XIX cWW cW-W 12 A.G577 A.A729 G-A -- -- cSS cm-m 13 A.G577 A.C764 G-C WC 19-XIX cWW cW-W 14 A.C578 A.G763 C-G WC 19-XIX cWW cW-W 15 A.G579 A.C762 G-C WC 19-XIX cWW cW-W 16 A.U580 A.G761 U-G Wobble 28-XXVIII cWW cW-W 17 A.G581 A.G760 G-G -- -- t.H t.-M 18 A.U582 A.A759 U-A rHoogsteen 24-XXIV tWH tW-M 19 A.A583 A.G758 A-G Sheared 11-XI tHS tM-m 20 A.G584 A.U757 G-U Wobble 28-XXVIII cWW cW-W 21 A.G585 A.C756 G-C WC 19-XIX cWW cW-W 22 A.C586 A.G755 C-G WC 19-XIX cWW cW-W 23 A.G588 A.C651 G-C WC 19-XIX cWW cW-W 24 A.C589 A.G650 C-G WC 19-XIX cWW cW-W 25 A.C590 A.G649 C-G WC 19-XIX cWW cW-W 26 A.U591 A.A648 U-A WC 20-XX cWW cW-W 27 A.G592 A.C647 G-C WC 19-XIX cWW cW-W 28 A.G593 A.U646 G-U Wobble 28-XXVIII cWW cW-W 29 A.G594 A.C645 G-C WC 19-XIX cWW cW-W 30 A.G595 A.C643 G-C -- -- tW. tW-. 31 A.G595 A.G644 G-G -- -- c.W c.-W 32 A.C596 A.G644 C-G WC 19-XIX cWW cW-W 33 A.G597 A.C643 G-C WC 19-XIX cWW cW-W 34 A.U598 A.A640 U-A WC 20-XX cWW cW-W 35 A.U598 A.A642 U-A -- -- c.W c.-W 36 A.C599 A.G639 C-G WC 19-XIX cWW cW-W 37 A.C600 A.G638 C-G WC 19-XIX cWW cW-W 38 A.C601 A.G637 C-G WC 19-XIX cWW cW-W 39 A.A602 A.U636 A-U WC 20-XX cWW cW-W 40 A.U603 A.G635 U-G Wobble 28-XXVIII cWW cW-W 41 A.G604 A.C634 G-C WC 19-XIX cWW cW-W 42 A.U605 A.G633 U-G Wobble 28-XXVIII cWW cW-W 43 A.G606 A.A632 G-A Sheared 11-XI tSH tm-M 44 A.A611 A.G629 A-G Imino 08-VIII cWW cW-W 45 A.C612 A.G628 C-G WC 19-XIX cWW cW-W 46 A.C613 A.G627 C-G WC 19-XIX cWW cW-W 47 A.A614 A.U626 A-U WC 20-XX cWW cW-W 48 A.C615 A.G625 C-G WC 19-XIX cWW cW-W 49 A.G616 A.C624 G-C WC 19-XIX cWW cW-W 50 A.G617 A.C623 G-C WC 19-XIX cWW cW-W 51 A.C618 A.A622 C-A ~rHoogsteen 25-XXV tWH tW-M 52 A.U641 A.A642 U+A Platform -- cSH cm+M 53 A.U641 A.C643 U+C -- -- cSH cm+M 54 A.U652 A.A753 U-A rHoogsteen 24-XXIV tWH tW-M 55 A.G654 A.G752 G-G -- -- tHS tM-m 56 A.G654 A.C754 G-C WC 19-XIX cWW cW-W 57 A.A655 A.U751 A-U WC 20-XX cWW cW-W 58 A.C656 A.G750 C-G WC 19-XIX cWW cW-W 59 A.G657 A.C749 G-C WC 19-XIX cWW cW-W 60 A.G658 A.C747 G-C WC 19-XIX cWW cW-W 61 A.U659 A.A746 U-A WC 20-XX cWW cW-W 62 A.G660 A.C745 G-C WC 19-XIX cWW cW-W 63 A.G661 A.C744 G-C WC 19-XIX cWW cW-W 64 A.G662 A.U743 G-U Wobble 28-XXVIII cWW cW-W 65 A.A663 A.G742 A-G Imino 08-VIII cWW cW-W 66 A.G664 A.G741 G-G -- -- cWW cW-W 67 A.A665 A.G724 A+G -- 09-IX cHW cM+W 68 A.G666 A.U740 G-U Wobble 28-XXVIII cWW cW-W 69 A.G667 A.C739 G-C WC 19-XIX cWW cW-W 70 A.G668 A.C738 G-C WC 19-XIX cWW cW-W 71 A.U669 A.A737 U-A WC 20-XX cWW cW-W 72 A.G670 A.C736 G-C WC 19-XIX cWW cW-W 73 A.G671 A.C735 G-C WC 19-XIX cWW cW-W 74 A.U672 A.G734 U-G Wobble 28-XXVIII cWW cW-W 75 A.G673 A.C717 G-C WC 19-XIX cWW cW-W 76 A.G674 A.A716 G-A Imino 08-VIII cWW cW-W 77 A.A675 A.A715 A-A -- -- cWW cW-W 78 A.A676 A.G714 A-G Imino 08-VIII cWW cW-W 79 A.U677 A.G713 U-G ~Wobble -- cWW cW-W 80 A.U678 A.A712 U-A WC 20-XX cWW cW-W 81 A.C679 A.G711 C-G WC 19-XIX cWW cW-W 82 A.C680 A.G710 C-G WC 19-XIX cWW cW-W 83 A.C681 A.G709 C-G WC 19-XIX cWW cW-W 84 A.G682 A.C708 G-C WC 19-XIX cWW cW-W 85 A.G683 A.C707 G-C WC 19-XIX cWW cW-W 86 A.A684 A.A706 A-A -- -- cWW cW-W 87 A.G685 A.A704 G-A -- -- tWH tW-M 88 A.G685 A.U705 G-U ~Sheared -- tSH tm-M 89 A.U686 A.A704 U-A rHoogsteen 24-XXIV tWH tW-M 90 A.A687 A.G700 A+G Linker -- tWS tW+m 91 A.A687 A.G703 A-G Sheared 11-XI tHS tM-m 92 A.G688 A.C699 G-C WC 19-XIX cWW cW-W 93 A.G688 A.A704 G+A Linker -- tSS tm+m 94 A.C689 A.G698 C-G WC 19-XIX cWW cW-W 95 A.G690 A.U697 G-U ~Sheared -- tSH tm-M 96 A.G691 A.A696 G-A Sheared 11-XI tSH tm-M 97 A.A695 A.G786 A-G -- -- cWS cW-m 98 A.G714 A.A777 G-A -- -- tSS tm-m 99 A.A722 A.A733 A+A -- 01-I tWW tW+W 100 A.G725 A.C732 G-C WC 19-XIX cWW cW-W 101 A.C726 A.G731 C-G WC 19-XIX cWW cW-W 102 A.G727 A.G730 G-G ~Sheared -- tSH tm-M 103 A.C748 A.C749 C+C Platform -- cSH cm+M 104 A.G752 A.C754 G+C -- -- cSH cm+M 105 A.G765 A.A816 G-A -- -- cSW cm-W 106 A.A766 A.U813 A-U rHoogsteen 24-XXIV tHW tM-W 107 A.A768 A.C811 A-C -- -- cWW cW-W 108 A.G769 A.C810 G-C WC 19-XIX cWW cW-W 109 A.G769 A.A900 G-A -- -- cSW cm-W 110 A.C770 A.G809 C-G WC 19-XIX cWW cW-W 111 A.C770 A.C899 C-C -- -- cSW cm-W 112 A.G771 A.C808 G-C WC 19-XIX cWW cW-W 113 A.U772 A.A807 U-A WC 20-XX cWW cW-W 114 A.G773 A.C806 G-C WC 19-XIX cWW cW-W 115 A.G774 A.C805 G-C WC 19-XIX cWW cW-W 116 A.G775 A.U804 G-U -- -- cWH cW-M 117 A.G776 A.G803 G-G -- -- tWH tW-M 118 A.G776 A.U804 G-U -- -- cSW cm-W 119 A.G778 A.U804 G-U Wobble 28-XXVIII cWW cW-W 120 A.C779 A.G803 C-G WC 19-XIX cWW cW-W 121 A.A780 A.A802 A-A ~Sheared -- tSH tm-M 122 A.A781 A.U801 A-U rHoogsteen 24-XXIV tHW tM-W 123 A.A782 A.G800 A-G Sheared 11-XI tHS tM-m 124 A.C783 A.G799 C-G WC 19-XIX cWW cW-W 125 A.C784 A.G798 C-G WC 19-XIX cWW cW-W 126 A.G785 A.C797 G-C WC 19-XIX cWW cW-W 127 A.G786 A.C796 G-C WC 19-XIX cWW cW-W 128 A.A787 A.C795 A-C -- -- cWH cW-M 129 A.U788 A.A794 U-A -- -- tWH tW-M 130 A.U788 A.C795 U-C -- -- cSW cm-W 131 A.C810 A.C899 C+C -- -- cSH cm+M 132 A.U820 A.A873 U+A Hoogsteen 23-XXIII cWH cW+M 133 A.G821 A.C879 G-C WC 19-XIX cWW cW-W 134 A.C822 A.G878 C-G WC 19-XIX cWW cW-W 135 A.G823 A.C877 G-C WC 19-XIX cWW cW-W 136 A.C824 A.G876 C-G WC 19-XIX cWW cW-W 137 A.G825 A.C875 G-C WC 19-XIX cWW cW-W 138 A.C826 A.G874 C-G WC 19-XIX cWW cW-W 139 A.U827 A.A859 U-A -- -- cSW cm-W 140 A.U827 A.A872 U+A rWC 21-XXI tWW tW+W 141 A.A828 A.G858 A-G Sheared 11-XI tHS tM-m 142 A.G829 A.C857 G-C WC 19-XIX cWW cW-W 143 A.G830 A.C856 G-C WC 19-XIX cWW cW-W 144 A.U831 A.G855 U-G Wobble 28-XXVIII cWW cW-W 145 A.C832 A.G854 C-G WC 19-XIX cWW cW-W 146 A.U833 A.G853 U-G Wobble 28-XXVIII cWW cW-W 147 A.C834 A.G852 C-G WC 19-XIX cWW cW-W 148 A.U835 A.G851 U-G Wobble 28-XXVIII cWW cW-W 149 A.G836 A.U850 G-U Wobble 28-XXVIII cWW cW-W 150 A.G837 A.C849 G-C WC 19-XIX cWW cW-W 151 A.G838 A.C848 G-C WC 19-XIX cWW cW-W 152 A.A860 A.G869 A-G Sheared 11-XI tHS tM-m 153 A.A860 A.A872 A-A -- -- tWH tW-M 154 A.G861 A.C868 G-C WC 19-XIX cWW cW-W 155 A.C862 A.G867 C-G WC 19-XIX cWW cW-W 156 A.U863 A.C866 U-C ~Sheared -- tSH tm-M 157 A.G867 A.A873 G+A Linker -- tSW tm+W 158 A.G885 A.C912 G-C WC 19-XIX cWW cW-W 159 A.G886 A.U911 G-U Wobble 28-XXVIII cWW cW-W 160 A.G887 A.C910 G-C WC 19-XIX cWW cW-W 161 A.G888 A.A909 G-A Sheared 11-XI tSH tm-M 162 A.A889 A.A908 A+A -- 02-II tHH tM+M 163 A.G890 A.U891 G+U Platform -- cSH cm+M 164 A.U891 A.A907 U-A rHoogsteen 24-XXIV tWH tW-M 165 A.A892 A.G906 A-G Sheared 11-XI tHS tM-m 166 A.G894 A.U905 G-U Wobble 28-XXVIII cWW cW-W 167 A.G895 A.C904 G-C WC 19-XIX cWW cW-W 168 A.C896 A.G903 C-G WC 19-XIX cWW cW-W 169 A.C897 A.G902 C-G WC 19-XIX cWW cW-W 170 A.G898 A.A901 G-A Sheared 11-XI tSH tm-M **************************************************************************** List of 22 multiplets 1 nts=3 GAC A.G567,A.A573,A.C883 2 nts=3 GAC A.G568,A.A574,A.C882 3 nts=3 GUC A.G570,A.U863,A.C866 4 nts=3 GGC A.G575,A.G576,A.C880 5 nts=3 GAC A.G577,A.A729,A.C764 6 nts=3 GCG A.G595,A.C596,A.G644 7 nts=3 GGC A.G595,A.G597,A.C643 8 nts=3 UAA A.U598,A.A640,A.A642 9 nts=3 GGC A.G654,A.G752,A.C754 10 nts=3 GCC A.G657,A.C748,A.C749 11 nts=3 AGA A.A676,A.G714,A.A777 12 nts=3 AGG A.A687,A.G700,A.G703 13 nts=3 AGC A.A695,A.G786,A.C796 14 nts=3 GCA A.G769,A.C810,A.A900 15 nts=3 CGC A.C770,A.G809,A.C899 16 nts=3 GGU A.G775,A.G778,A.U804 17 nts=3 GCG A.G776,A.C779,A.G803 18 nts=3 UAA A.U827,A.A859,A.A872 19 nts=3 GUA A.G890,A.U891,A.A907 20 nts=4 GGCA A.G685,A.G688,A.C699,A.A704 21 nts=4 UCGA A.U820,A.C862,A.G867,A.A873 22 nts=4 UAGA A.U827,A.A860,A.G869,A.A872 **************************************************************************** List of 11 helices Note: a helix is defined by base-stacking interactions, regardless of bp type and backbone connectivity, and may contain more than one stem. helix#number[stems-contained] bps=number-of-base-pairs in the helix bp-type: '|' for a canonical WC/wobble pair, '.' otherwise helix-form: classification of a dinucleotide step comprising the bp above the given designation and the bp that follows it. Types include 'A', 'B' or 'Z' for the common A-, B- and Z-form helices, '.' for an unclassified step, and 'x' for a step without a continuous backbone. -------------------------------------------------------------------- helix#1[2] bps=12 strand-1 5'-AGGCGGCGCGCU-3' bp-type .||||||||||. strand-2 3'-UCCGCCGCGCGA-5' helix-form x.AxxAAA..x 1 A.A563 A.U884 A+U rWC 21-XXI tWW tW+W 2 A.G567 A.C883 G-C WC 19-XIX cWW cW-W 3 A.G568 A.C882 G-C WC 19-XIX cWW cW-W 4 A.C569 A.G881 C-G WC 19-XIX cWW cW-W 5 A.G575 A.C880 G-C WC 19-XIX cWW cW-W 6 A.G821 A.C879 G-C WC 19-XIX cWW cW-W 7 A.C822 A.G878 C-G WC 19-XIX cWW cW-W 8 A.G823 A.C877 G-C WC 19-XIX cWW cW-W 9 A.C824 A.G876 C-G WC 19-XIX cWW cW-W 10 A.G825 A.C875 G-C WC 19-XIX cWW cW-W 11 A.C826 A.G874 C-G WC 19-XIX cWW cW-W 12 A.U827 A.A872 U+A rWC 21-XXI tWW tW+W -------------------------------------------------------------------------- helix#2[1] bps=3 strand-1 5'-GUA-3' bp-type ||. strand-2 3'-CAA-5' helix-form .x 1 A.G570 A.C866 G-C WC 19-XIX cWW cW-W 2 A.U571 A.A865 U-A WC 20-XX cWW cW-W 3 A.A572 A.A574 A-A -- -- cHH cM-M -------------------------------------------------------------------------- helix#3[1] bps=4 strand-1 5'-AGGC-3' bp-type .||| strand-2 3'-GUCG-5' helix-form ..A 1 A.A583 A.G758 A-G Sheared 11-XI tHS tM-m 2 A.G584 A.U757 G-U Wobble 28-XXVIII cWW cW-W 3 A.G585 A.C756 G-C WC 19-XIX cWW cW-W 4 A.C586 A.G755 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#4[1] bps=9 strand-1 5'-UCCCAUGUG-3' bp-type ||||||||. strand-2 3'-AGGGUGCGA-5' helix-form AAAA.... 1 A.U598 A.A640 U-A WC 20-XX cWW cW-W 2 A.C599 A.G639 C-G WC 19-XIX cWW cW-W 3 A.C600 A.G638 C-G WC 19-XIX cWW cW-W 4 A.C601 A.G637 C-G WC 19-XIX cWW cW-W 5 A.A602 A.U636 A-U WC 20-XX cWW cW-W 6 A.U603 A.G635 U-G Wobble 28-XXVIII cWW cW-W 7 A.G604 A.C634 G-C WC 19-XIX cWW cW-W 8 A.U605 A.G633 U-G Wobble 28-XXVIII cWW cW-W 9 A.G606 A.A632 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#5[1] bps=8 strand-1 5'-ACCACGGC-3' bp-type .||||||. strand-2 3'-GGGUGCCA-5' helix-form .AAA.A. 1 A.A611 A.G629 A-G Imino 08-VIII cWW cW-W 2 A.C612 A.G628 C-G WC 19-XIX cWW cW-W 3 A.C613 A.G627 C-G WC 19-XIX cWW cW-W 4 A.A614 A.U626 A-U WC 20-XX cWW cW-W 5 A.C615 A.G625 C-G WC 19-XIX cWW cW-W 6 A.G616 A.C624 G-C WC 19-XIX cWW cW-W 7 A.G617 A.C623 G-C WC 19-XIX cWW cW-W 8 A.C618 A.A622 C-A ~rHoogsteen 25-XXV tWH tW-M -------------------------------------------------------------------------- helix#6[6] bps=44 strand-1 5'-ACGCUCAGGCUGACGGUGGGAGGGGUGGUGGAAUUCCCGGAGUA-3' bp-type .|||||||||.|||||||||..||||||||....||||||.... strand-2 3'-UGCGGGUCCGACUGCCACCUGGUCCACCGCAAGGAGGGCCAUAG-5' helix-form x.xA.AA..xxxA.xAAA...x.AAAA.xA....AAAAA.... 1 A.A642 A.U641 A+U Platform -- cHS cM+m 2 A.C643 A.G597 C-G WC 19-XIX cWW cW-W 3 A.G644 A.C596 G-C WC 19-XIX cWW cW-W 4 A.C645 A.G594 C-G WC 19-XIX cWW cW-W 5 A.U646 A.G593 U-G Wobble 28-XXVIII cWW cW-W 6 A.C647 A.G592 C-G WC 19-XIX cWW cW-W 7 A.A648 A.U591 A-U WC 20-XX cWW cW-W 8 A.G649 A.C590 G-C WC 19-XIX cWW cW-W 9 A.G650 A.C589 G-C WC 19-XIX cWW cW-W 10 A.C651 A.G588 C-G WC 19-XIX cWW cW-W 11 A.U652 A.A753 U-A rHoogsteen 24-XXIV tWH tW-M 12 A.G654 A.C754 G-C WC 19-XIX cWW cW-W 13 A.A655 A.U751 A-U WC 20-XX cWW cW-W 14 A.C656 A.G750 C-G WC 19-XIX cWW cW-W 15 A.G657 A.C749 G-C WC 19-XIX cWW cW-W 16 A.G658 A.C747 G-C WC 19-XIX cWW cW-W 17 A.U659 A.A746 U-A WC 20-XX cWW cW-W 18 A.G660 A.C745 G-C WC 19-XIX cWW cW-W 19 A.G661 A.C744 G-C WC 19-XIX cWW cW-W 20 A.G662 A.U743 G-U Wobble 28-XXVIII cWW cW-W 21 A.A663 A.G742 A-G Imino 08-VIII cWW cW-W 22 A.G664 A.G741 G-G -- -- cWW cW-W 23 A.G666 A.U740 G-U Wobble 28-XXVIII cWW cW-W 24 A.G667 A.C739 G-C WC 19-XIX cWW cW-W 25 A.G668 A.C738 G-C WC 19-XIX cWW cW-W 26 A.U669 A.A737 U-A WC 20-XX cWW cW-W 27 A.G670 A.C736 G-C WC 19-XIX cWW cW-W 28 A.G671 A.C735 G-C WC 19-XIX cWW cW-W 29 A.U672 A.G734 U-G Wobble 28-XXVIII cWW cW-W 30 A.G673 A.C717 G-C WC 19-XIX cWW cW-W 31 A.G674 A.A716 G-A Imino 08-VIII cWW cW-W 32 A.A675 A.A715 A-A -- -- cWW cW-W 33 A.A676 A.G714 A-G Imino 08-VIII cWW cW-W 34 A.U677 A.G713 U-G ~Wobble -- cWW cW-W 35 A.U678 A.A712 U-A WC 20-XX cWW cW-W 36 A.C679 A.G711 C-G WC 19-XIX cWW cW-W 37 A.C680 A.G710 C-G WC 19-XIX cWW cW-W 38 A.C681 A.G709 C-G WC 19-XIX cWW cW-W 39 A.G682 A.C708 G-C WC 19-XIX cWW cW-W 40 A.G683 A.C707 G-C WC 19-XIX cWW cW-W 41 A.A684 A.A706 A-A -- -- cWW cW-W 42 A.G685 A.U705 G-U ~Sheared -- tSH tm-M 43 A.U686 A.A704 U-A rHoogsteen 24-XXIV tWH tW-M 44 A.A687 A.G703 A-G Sheared 11-XI tHS tM-m -------------------------------------------------------------------------- helix#7[1] bps=4 strand-1 5'-GCGG-3' bp-type ||.. strand-2 3'-CGUA-5' helix-form A.. 1 A.G688 A.C699 G-C WC 19-XIX cWW cW-W 2 A.C689 A.G698 C-G WC 19-XIX cWW cW-W 3 A.G690 A.U697 G-U ~Sheared -- tSH tm-M 4 A.G691 A.A696 G-A Sheared 11-XI tSH tm-M -------------------------------------------------------------------------- helix#8[1] bps=5 strand-1 5'-AGGCG-3' bp-type ..||. strand-2 3'-AACGG-5' helix-form xxA. 1 A.A722 A.A733 A+A -- 01-I tWW tW+W 2 A.G724 A.A665 G+A -- 09-IX cWH cW+M 3 A.G725 A.C732 G-C WC 19-XIX cWW cW-W 4 A.C726 A.G731 C-G WC 19-XIX cWW cW-W 5 A.G727 A.G730 G-G ~Sheared -- tSH tm-M -------------------------------------------------------------------------- helix#9[4] bps=25 strand-1 5'-AGGCGCGAAGCGUGGGCAAACCGGU-3' bp-type ..||||...||||||||...||||. strand-2 3'-UGUGCGAUCCGCACCUGAUGGGCCC-5' helix-form ...AAxxx..AAAAx.......Ax 1 A.A759 A.U582 A-U rHoogsteen 24-XXIV tHW tM-W 2 A.G760 A.G581 G-G -- -- tH. tM-. 3 A.G761 A.U580 G-U Wobble 28-XXVIII cWW cW-W 4 A.C762 A.G579 C-G WC 19-XIX cWW cW-W 5 A.G763 A.C578 G-C WC 19-XIX cWW cW-W 6 A.C764 A.G577 C-G WC 19-XIX cWW cW-W 7 A.G765 A.A816 G-A -- -- cSW cm-W 8 A.A766 A.U813 A-U rHoogsteen 24-XXIV tHW tM-W 9 A.A768 A.C811 A-C -- -- cWW cW-W 10 A.G769 A.C810 G-C WC 19-XIX cWW cW-W 11 A.C770 A.G809 C-G WC 19-XIX cWW cW-W 12 A.G771 A.C808 G-C WC 19-XIX cWW cW-W 13 A.U772 A.A807 U-A WC 20-XX cWW cW-W 14 A.G773 A.C806 G-C WC 19-XIX cWW cW-W 15 A.G774 A.C805 G-C WC 19-XIX cWW cW-W 16 A.G778 A.U804 G-U Wobble 28-XXVIII cWW cW-W 17 A.C779 A.G803 C-G WC 19-XIX cWW cW-W 18 A.A780 A.A802 A-A ~Sheared -- tSH tm-M 19 A.A781 A.U801 A-U rHoogsteen 24-XXIV tHW tM-W 20 A.A782 A.G800 A-G Sheared 11-XI tHS tM-m 21 A.C783 A.G799 C-G WC 19-XIX cWW cW-W 22 A.C784 A.G798 C-G WC 19-XIX cWW cW-W 23 A.G785 A.C797 G-C WC 19-XIX cWW cW-W 24 A.G786 A.C796 G-C WC 19-XIX cWW cW-W 25 A.U788 A.C795 U-C -- -- cSW cm-W -------------------------------------------------------------------------- helix#10[2] bps=14 strand-1 5'-CCUGGGGGCCGAGC-3' bp-type ||||||||||..|| strand-2 3'-GGGUCUCUGGAGCG-5' helix-form .......AA.x.A 1 A.C848 A.G838 C-G WC 19-XIX cWW cW-W 2 A.C849 A.G837 C-G WC 19-XIX cWW cW-W 3 A.U850 A.G836 U-G Wobble 28-XXVIII cWW cW-W 4 A.G851 A.U835 G-U Wobble 28-XXVIII cWW cW-W 5 A.G852 A.C834 G-C WC 19-XIX cWW cW-W 6 A.G853 A.U833 G-U Wobble 28-XXVIII cWW cW-W 7 A.G854 A.C832 G-C WC 19-XIX cWW cW-W 8 A.G855 A.U831 G-U Wobble 28-XXVIII cWW cW-W 9 A.C856 A.G830 C-G WC 19-XIX cWW cW-W 10 A.C857 A.G829 C-G WC 19-XIX cWW cW-W 11 A.G858 A.A828 G-A Sheared 11-XI tSH tm-M 12 A.A860 A.G869 A-G Sheared 11-XI tHS tM-m 13 A.G861 A.C868 G-C WC 19-XIX cWW cW-W 14 A.C862 A.G867 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- helix#11[2] bps=12 strand-1 5'-GGGGAUAGGCCG-3' bp-type |||....||||. strand-2 3'-CUCAAAGUCGGA-5' helix-form ....x.x.AA. 1 A.G885 A.C912 G-C WC 19-XIX cWW cW-W 2 A.G886 A.U911 G-U Wobble 28-XXVIII cWW cW-W 3 A.G887 A.C910 G-C WC 19-XIX cWW cW-W 4 A.G888 A.A909 G-A Sheared 11-XI tSH tm-M 5 A.A889 A.A908 A+A -- 02-II tHH tM+M 6 A.U891 A.A907 U-A rHoogsteen 24-XXIV tWH tW-M 7 A.A892 A.G906 A-G Sheared 11-XI tHS tM-m 8 A.G894 A.U905 G-U Wobble 28-XXVIII cWW cW-W 9 A.G895 A.C904 G-C WC 19-XIX cWW cW-W 10 A.C896 A.G903 C-G WC 19-XIX cWW cW-W 11 A.C897 A.G902 C-G WC 19-XIX cWW cW-W 12 A.G898 A.A901 G-A Sheared 11-XI tSH tm-M **************************************************************************** List of 22 stems Note: a stem is defined as a helix consisting of only canonical WC/wobble pairs, with a continuous backbone. stem#number[#helix-number containing this stem] Other terms are defined as in the above Helix section. -------------------------------------------------------------------- stem#1[#1] bps=3 strand-1 5'-GGC-3' bp-type ||| strand-2 3'-CCG-5' helix-form .A 1 A.G567 A.C883 G-C WC 19-XIX cWW cW-W 2 A.G568 A.C882 G-C WC 19-XIX cWW cW-W 3 A.C569 A.G881 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#2[#2] bps=2 strand-1 5'-GU-3' bp-type || strand-2 3'-CA-5' helix-form . 1 A.G570 A.C866 G-C WC 19-XIX cWW cW-W 2 A.U571 A.A865 U-A WC 20-XX cWW cW-W -------------------------------------------------------------------------- stem#3[#9] bps=4 strand-1 5'-GCGU-3' bp-type |||| strand-2 3'-CGCG-5' helix-form AA. 1 A.G577 A.C764 G-C WC 19-XIX cWW cW-W 2 A.C578 A.G763 C-G WC 19-XIX cWW cW-W 3 A.G579 A.C762 G-C WC 19-XIX cWW cW-W 4 A.U580 A.G761 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#4[#3] bps=3 strand-1 5'-GGC-3' bp-type ||| strand-2 3'-UCG-5' helix-form .A 1 A.G584 A.U757 G-U Wobble 28-XXVIII cWW cW-W 2 A.G585 A.C756 G-C WC 19-XIX cWW cW-W 3 A.C586 A.G755 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#5[#6] bps=7 strand-1 5'-GCCUGGG-3' bp-type ||||||| strand-2 3'-CGGACUC-5' helix-form ..AA.A 1 A.G588 A.C651 G-C WC 19-XIX cWW cW-W 2 A.C589 A.G650 C-G WC 19-XIX cWW cW-W 3 A.C590 A.G649 C-G WC 19-XIX cWW cW-W 4 A.U591 A.A648 U-A WC 20-XX cWW cW-W 5 A.G592 A.C647 G-C WC 19-XIX cWW cW-W 6 A.G593 A.U646 G-U Wobble 28-XXVIII cWW cW-W 7 A.G594 A.C645 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#6[#6] bps=2 strand-1 5'-CG-3' bp-type || strand-2 3'-GC-5' helix-form . 1 A.C596 A.G644 C-G WC 19-XIX cWW cW-W 2 A.G597 A.C643 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#7[#4] bps=8 strand-1 5'-UCCCAUGU-3' bp-type |||||||| strand-2 3'-AGGGUGCG-5' helix-form AAAA... 1 A.U598 A.A640 U-A WC 20-XX cWW cW-W 2 A.C599 A.G639 C-G WC 19-XIX cWW cW-W 3 A.C600 A.G638 C-G WC 19-XIX cWW cW-W 4 A.C601 A.G637 C-G WC 19-XIX cWW cW-W 5 A.A602 A.U636 A-U WC 20-XX cWW cW-W 6 A.U603 A.G635 U-G Wobble 28-XXVIII cWW cW-W 7 A.G604 A.C634 G-C WC 19-XIX cWW cW-W 8 A.U605 A.G633 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#8[#5] bps=6 strand-1 5'-CCACGG-3' bp-type |||||| strand-2 3'-GGUGCC-5' helix-form AAA.A 1 A.C612 A.G628 C-G WC 19-XIX cWW cW-W 2 A.C613 A.G627 C-G WC 19-XIX cWW cW-W 3 A.A614 A.U626 A-U WC 20-XX cWW cW-W 4 A.C615 A.G625 C-G WC 19-XIX cWW cW-W 5 A.G616 A.C624 G-C WC 19-XIX cWW cW-W 6 A.G617 A.C623 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#9[#6] bps=3 strand-1 5'-ACG-3' bp-type ||| strand-2 3'-UGC-5' helix-form A. 1 A.A655 A.U751 A-U WC 20-XX cWW cW-W 2 A.C656 A.G750 C-G WC 19-XIX cWW cW-W 3 A.G657 A.C749 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#10[#6] bps=5 strand-1 5'-GUGGG-3' bp-type ||||| strand-2 3'-CACCU-5' helix-form AAA. 1 A.G658 A.C747 G-C WC 19-XIX cWW cW-W 2 A.U659 A.A746 U-A WC 20-XX cWW cW-W 3 A.G660 A.C745 G-C WC 19-XIX cWW cW-W 4 A.G661 A.C744 G-C WC 19-XIX cWW cW-W 5 A.G662 A.U743 G-U Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#11[#6] bps=7 strand-1 5'-GGGUGGU-3' bp-type ||||||| strand-2 3'-UCCACCG-5' helix-form .AAAA. 1 A.G666 A.U740 G-U Wobble 28-XXVIII cWW cW-W 2 A.G667 A.C739 G-C WC 19-XIX cWW cW-W 3 A.G668 A.C738 G-C WC 19-XIX cWW cW-W 4 A.U669 A.A737 U-A WC 20-XX cWW cW-W 5 A.G670 A.C736 G-C WC 19-XIX cWW cW-W 6 A.G671 A.C735 G-C WC 19-XIX cWW cW-W 7 A.U672 A.G734 U-G Wobble 28-XXVIII cWW cW-W -------------------------------------------------------------------------- stem#12[#6] bps=6 strand-1 5'-UCCCGG-3' bp-type |||||| strand-2 3'-AGGGCC-5' helix-form AAAAA 1 A.U678 A.A712 U-A WC 20-XX cWW cW-W 2 A.C679 A.G711 C-G WC 19-XIX cWW cW-W 3 A.C680 A.G710 C-G WC 19-XIX cWW cW-W 4 A.C681 A.G709 C-G WC 19-XIX cWW cW-W 5 A.G682 A.C708 G-C WC 19-XIX cWW cW-W 6 A.G683 A.C707 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#13[#7] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form A 1 A.G688 A.C699 G-C WC 19-XIX cWW cW-W 2 A.C689 A.G698 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#14[#8] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form A 1 A.G725 A.C732 G-C WC 19-XIX cWW cW-W 2 A.C726 A.G731 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#15[#9] bps=6 strand-1 5'-GCGUGG-3' bp-type |||||| strand-2 3'-CGCACC-5' helix-form .AAAA 1 A.G769 A.C810 G-C WC 19-XIX cWW cW-W 2 A.C770 A.G809 C-G WC 19-XIX cWW cW-W 3 A.G771 A.C808 G-C WC 19-XIX cWW cW-W 4 A.U772 A.A807 U-A WC 20-XX cWW cW-W 5 A.G773 A.C806 G-C WC 19-XIX cWW cW-W 6 A.G774 A.C805 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#16[#9] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-UG-5' helix-form . 1 A.G778 A.U804 G-U Wobble 28-XXVIII cWW cW-W 2 A.C779 A.G803 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#17[#9] bps=4 strand-1 5'-CCGG-3' bp-type |||| strand-2 3'-GGCC-5' helix-form ..A 1 A.C783 A.G799 C-G WC 19-XIX cWW cW-W 2 A.C784 A.G798 C-G WC 19-XIX cWW cW-W 3 A.G785 A.C797 G-C WC 19-XIX cWW cW-W 4 A.G786 A.C796 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#18[#1] bps=6 strand-1 5'-GCGCGC-3' bp-type |||||| strand-2 3'-CGCGCG-5' helix-form AAA.. 1 A.G821 A.C879 G-C WC 19-XIX cWW cW-W 2 A.C822 A.G878 C-G WC 19-XIX cWW cW-W 3 A.G823 A.C877 G-C WC 19-XIX cWW cW-W 4 A.C824 A.G876 C-G WC 19-XIX cWW cW-W 5 A.G825 A.C875 G-C WC 19-XIX cWW cW-W 6 A.C826 A.G874 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#19[#10] bps=10 strand-1 5'-GGUCUCUGGG-3' bp-type |||||||||| strand-2 3'-CCGGGGGUCC-5' helix-form AA....... 1 A.G829 A.C857 G-C WC 19-XIX cWW cW-W 2 A.G830 A.C856 G-C WC 19-XIX cWW cW-W 3 A.U831 A.G855 U-G Wobble 28-XXVIII cWW cW-W 4 A.C832 A.G854 C-G WC 19-XIX cWW cW-W 5 A.U833 A.G853 U-G Wobble 28-XXVIII cWW cW-W 6 A.C834 A.G852 C-G WC 19-XIX cWW cW-W 7 A.U835 A.G851 U-G Wobble 28-XXVIII cWW cW-W 8 A.G836 A.U850 G-U Wobble 28-XXVIII cWW cW-W 9 A.G837 A.C849 G-C WC 19-XIX cWW cW-W 10 A.G838 A.C848 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#20[#10] bps=2 strand-1 5'-GC-3' bp-type || strand-2 3'-CG-5' helix-form A 1 A.G861 A.C868 G-C WC 19-XIX cWW cW-W 2 A.C862 A.G867 C-G WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#21[#11] bps=3 strand-1 5'-GGG-3' bp-type ||| strand-2 3'-CUC-5' helix-form .. 1 A.G885 A.C912 G-C WC 19-XIX cWW cW-W 2 A.G886 A.U911 G-U Wobble 28-XXVIII cWW cW-W 3 A.G887 A.C910 G-C WC 19-XIX cWW cW-W -------------------------------------------------------------------------- stem#22[#11] bps=4 strand-1 5'-GGCC-3' bp-type |||| strand-2 3'-UCGG-5' helix-form .AA 1 A.G894 A.U905 G-U Wobble 28-XXVIII cWW cW-W 2 A.G895 A.C904 G-C WC 19-XIX cWW cW-W 3 A.C896 A.G903 C-G WC 19-XIX cWW cW-W 4 A.C897 A.G902 C-G WC 19-XIX cWW cW-W **************************************************************************** List of 3 isolated WC/wobble pairs Note: isolated WC/wobble pairs are assigned negative indices to differentiate them from the stem numbers, which are positive. -------------------------------------------------------------------- [#1] -1 A.G575 A.C880 G-C WC 19-XIX cWW cW-W [#6] -2 A.G654 A.C754 G-C WC 19-XIX cWW cW-W [#6] -3 A.G673 A.C717 G-C WC 19-XIX cWW cW-W **************************************************************************** List of 5 coaxial stacks 1 Helix#1 contains 2 stems: [#1,#18] 2 Helix#6 contains 6 stems: [#6,#5,#9,#10,#11,#12] 3 Helix#9 contains 4 stems: [#3,#15,#16,#17] 4 Helix#10 contains 2 stems: [#19,#20] 5 Helix#11 contains 2 stems: [#21,#22] **************************************************************************** List of 63 base stacks Note: a stack is an ordered list of nucleotides assembled together via base-stacking interactions, regardless of backbone connectivity. Stacking interactions within a stem are *not* included. 1 nts=2 AG A.A563,A.G567 2 nts=2 GA A.G570,A.A873 3 nts=2 AA A.A573,A.A574 4 nts=2 GG A.G587,A.G755 5 nts=2 GU A.G597,A.U598 6 nts=2 GC A.G617,A.C618 7 nts=2 AG A.A632,A.G633 8 nts=2 AC A.A642,A.C643 9 nts=2 GC A.G644,A.C645 10 nts=2 GG A.G657,A.G658 11 nts=2 GG A.G688,A.G700 12 nts=2 CG A.C701,A.G703 13 nts=2 GG A.G727,A.G731 14 nts=2 CC A.C747,A.C748 15 nts=2 AG A.A777,A.G778 16 nts=2 UC A.U804,A.C805 17 nts=2 CA A.C817,A.A819 18 nts=2 GU A.G818,A.U820 19 nts=2 UU A.U827,A.U870 20 nts=2 GC A.G838,A.C840 21 nts=2 CU A.C862,A.U863 22 nts=2 CG A.C866,A.G867 23 nts=2 AG A.A872,A.G874 24 nts=2 CC A.C879,A.C880 25 nts=2 GG A.G898,A.G902 26 nts=2 CA A.C912,A.A913 27 nts=3 CUC A.C562,A.U884,A.C883 28 nts=3 CUG A.C564,A.U565,A.G566 29 nts=3 AAA A.A572,A.A864,A.A865 30 nts=3 GAU A.G577,A.A816,A.U813 31 nts=3 GAG A.G662,A.A663,A.G664 32 nts=3 AAG A.A728,A.A729,A.G730 33 nts=3 CAA A.C732,A.A665,A.A733 34 nts=3 GGG A.G774,A.G775,A.G776 35 nts=3 GGG A.G821,A.G575,A.G881 36 nts=3 GGU A.G890,A.G906,A.U905 37 nts=3 CAA A.C899,A.A900,A.A901 38 nts=4 UGGU A.U580,A.G581,A.G758,A.U757 39 nts=4 GAGA A.G588,A.A753,A.G654,A.A655 40 nts=4 GGUA A.G594,A.G595,A.U641,A.A640 41 nts=4 CAAC A.C620,A.A621,A.A622,A.C623 42 nts=4 CUGU A.C651,A.U652,A.G752,A.U751 43 nts=4 GGGU A.G666,A.G741,A.G742,A.U743 44 nts=4 GAGU A.G683,A.A684,A.G685,A.U686 45 nts=4 CGGU A.C689,A.G690,A.G691,A.U692 46 nts=4 CAGG A.C779,A.A780,A.G800,A.G799 47 nts=4 GAUU A.G786,A.A787,A.U788,A.U789 48 nts=4 CGGC A.C857,A.G858,A.G869,A.C868 49 nts=4 GGAU A.G887,A.G888,A.A889,A.U891 50 nts=5 GAUGG A.G584,A.A583,A.U582,A.G760,A.G761 51 nts=5 AAUAC A.A687,A.A704,A.U705,A.A706,A.C707 52 nts=5 CGCCC A.C764,A.G765,A.C812,A.C811,A.C810 53 nts=5 GAAAA A.G769,A.A768,A.A767,A.A766,A.A814 54 nts=5 CAUAG A.C783,A.A782,A.U801,A.A802,A.G803 55 nts=5 GAAAG A.G829,A.A828,A.A859,A.A860,A.G861 56 nts=6 UGGGGG A.U605,A.G606,A.G631,A.G630,A.G629,A.G628 57 nts=6 AAAGAC A.A607,A.A608,A.A609,A.G610,A.A611,A.C612 58 nts=6 GAAAUG A.G693,A.A694,A.A695,A.A696,A.U697,A.G698 59 nts=6 AGGAAC A.A712,A.G713,A.G714,A.A715,A.A716,A.C717 60 nts=6 AGAACC A.A790,A.G791,A.A792,A.A794,A.C795,A.C796 61 nts=7 UUAAGGG A.U678,A.U677,A.A676,A.A675,A.G674,A.G673,A.G734 62 nts=7 GCCGAGG A.G718,A.C719,A.C720,A.G721,A.A722,A.G724,A.G725 63 nts=7 GCAAAAC A.G894,A.C893,A.A892,A.A907,A.A908,A.A909,A.C910 **************************************************************************** Nucleotides not involved in stacking interactions nts=12 GCUAAUCUAUUU A.G576,A.C596,A.U619,A.A653,A.A702,A.U723,A.C754,A.U793,A.A815,A.U839,A.U841,A.U871 **************************************************************************** List of 19 atom-base capping interactions dv: vertical distance of the atom above the nucleotide base ----------------------------------------------------------- type atom nt dv 1 sugar O4'@A.C569 A.A574 2.99 2 sugar O2'@A.G881 A.G576 3.48 3 sugar O4'@A.U598 A.G597 3.28 4 sugar O4'@A.C701 A.G703 3.20 5 sugar O4'@A.G721 A.A722 2.84 6 sugar O2'@A.A722 A.U723 2.93 7 phosphate OP2@A.A729 A.G727 3.05 8 sugar O4'@A.G731 A.G730 3.39 9 phosphate OP2@A.G791 A.U789 3.12 10 sugar O4'@A.A816 A.A814 3.29 11 sugar O4'@A.G577 A.A816 3.03 12 sugar O4'@A.A819 A.C817 2.75 13 sugar O2'@A.U820 A.G818 3.10 14 sugar O4'@A.G570 A.U820 3.01 15 sugar O4'@A.A859 A.A828 2.98 16 phosphate OP2@A.G854 A.U871 3.49 17 sugar O4'@A.C868 A.A873 2.98 18 phosphate OP2@A.A900 A.G898 3.27 19 sugar O4'@A.G902 A.A901 3.46 **************************************************************************** Note: for the various types of loops listed below, numbers within the first set of brackets are the number of loop nts, and numbers in the second set of brackets are the identities of the stems (positive number) or isolated WC/wobble pairs (negative numbers) to which they are linked. **************************************************************************** List of 7 hairpin loops 1 hairpin loop: nts=7; [5]; linked by [#8] summary: [1] 5 [A.617 A.623] 6 nts=7 GCUCAAC A.G617,A.C618,A.U619,A.C620,A.A621,A.A622,A.C623 nts=5 CUCAA A.C618,A.U619,A.C620,A.A621,A.A622 2 hairpin loop: nts=10; [8]; linked by [#13] summary: [1] 8 [A.689 A.698] 2 nts=10 CGGUGAAAUG A.C689,A.G690,A.G691,A.U692,A.G693,A.A694,A.A695,A.A696,A.U697,A.G698 nts=8 GGUGAAAU A.G690,A.G691,A.U692,A.G693,A.A694,A.A695,A.A696,A.U697 3 hairpin loop: nts=6; [4]; linked by [#14] summary: [1] 4 [A.726 A.731] 2 nts=6 CGAAGG A.C726,A.G727,A.A728,A.A729,A.G730,A.G731 nts=4 GAAG A.G727,A.A728,A.A729,A.G730 4 hairpin loop: nts=11; [9]; linked by [#17] summary: [1] 9 [A.786 A.796] 4 nts=11 GAUUAGAUACC A.G786,A.A787,A.U788,A.U789,A.A790,A.G791,A.A792,A.U793,A.A794,A.C795,A.C796 nts=9 AUUAGAUAC A.A787,A.U788,A.U789,A.A790,A.G791,A.A792,A.U793,A.A794,A.C795 5 hairpin loop: nts=5; [3]; linked by [#19] summary: [1] 3 [A.838 A.848] 10 nts=5 GUCUC A.G838,A.U839,A.C840,A.U841,A.C848 nts=3 UCU A.U839,A.C840,A.U841 6 hairpin loop: nts=6; [4]; linked by [#20] summary: [1] 4 [A.862 A.867] 2 nts=6 CUAACG A.C862,A.U863,A.A864,A.A865,A.C866,A.G867 nts=4 UAAC A.U863,A.A864,A.A865,A.C866 7 hairpin loop: nts=6; [4]; linked by [#22] summary: [1] 4 [A.897 A.902] 4 nts=6 CGCAAG A.C897,A.G898,A.C899,A.A900,A.A901,A.G902 nts=4 GCAA A.G898,A.C899,A.A900,A.A901 **************************************************************************** List of 5 bulges 1 bulge: nts=5; [1,0]; linked by [#5,#6] summary: [2] 1 0 [A.594 A.645 A.596 A.644] 7 2 nts=5 GGCGC A.G594,A.G595,A.C596,A.G644,A.C645 nts=1 G A.G595 nts=0 2 bulge: nts=5; [0,1]; linked by [#9,#10] summary: [2] 0 1 [A.657 A.749 A.658 A.747] 3 5 nts=5 GGCCC A.G657,A.G658,A.C747,A.C748,A.C749 nts=0 nts=1 C A.C748 3 bulge: nts=6; [0,2]; linked by [#6,#7] summary: [2] 0 2 [A.597 A.643 A.598 A.640] 2 8 nts=6 GUAUAC A.G597,A.U598,A.A640,A.U641,A.A642,A.C643 nts=0 nts=2 UA A.U641,A.A642 4 bulge: nts=6; [0,2]; linked by [#-2,#9] summary: [2] 0 2 [A.654 A.754 A.655 A.751] 1 3 nts=6 GAUGAC A.G654,A.A655,A.U751,A.G752,A.A753,A.C754 nts=0 nts=2 GA A.G752,A.A753 5 bulge: nts=7; [3,0]; linked by [#15,#16] summary: [2] 3 0 [A.774 A.805 A.778 A.804] 6 2 nts=7 GGGAGUC A.G774,A.G775,A.G776,A.A777,A.G778,A.U804,A.C805 nts=3 GGA A.G775,A.G776,A.A777 nts=0 **************************************************************************** List of 7 internal loops 1 asymmetric internal loop: nts=9; [3,2]; linked by [#10,#11] summary: [2] 3 2 [A.662 A.743 A.666 A.740] 5 7 nts=9 GAGAGUGGU A.G662,A.A663,A.G664,A.A665,A.G666,A.U740,A.G741,A.G742,A.U743 nts=3 AGA A.A663,A.G664,A.A665 nts=2 GG A.G741,A.G742 2 symmetric internal loop: nts=10; [3,3]; linked by [#3,#4] summary: [2] 3 3 [A.580 A.761 A.584 A.757] 4 3 nts=10 UGUAGUGAGG A.U580,A.G581,A.U582,A.A583,A.G584,A.U757,A.G758,A.A759,A.G760,A.G761 nts=3 GUA A.G581,A.U582,A.A583 nts=3 GAG A.G758,A.A759,A.G760 3 symmetric internal loop: nts=10; [3,3]; linked by [#16,#17] summary: [2] 3 3 [A.779 A.803 A.783 A.799] 2 4 nts=10 CAAACGGUAG A.C779,A.A780,A.A781,A.A782,A.C783,A.G799,A.G800,A.U801,A.A802,A.G803 nts=3 AAA A.A780,A.A781,A.A782 nts=3 GUA A.G800,A.U801,A.A802 4 symmetric internal loop: nts=12; [4,4]; linked by [#-3,#12] summary: [2] 4 4 [A.673 A.717 A.678 A.712] 1 6 nts=12 GGAAUUAGGAAC A.G673,A.G674,A.A675,A.A676,A.U677,A.U678,A.A712,A.G713,A.G714,A.A715,A.A716,A.C717 nts=4 GAAU A.G674,A.A675,A.A676,A.U677 nts=4 GGAA A.G713,A.G714,A.A715,A.A716 5 asymmetric internal loop: nts=14; [6,4]; linked by [#7,#8] summary: [2] 6 4 [A.605 A.633 A.612 A.628] 8 6 nts=14 UGAAAGACGGGGAG A.U605,A.G606,A.A607,A.A608,A.A609,A.G610,A.A611,A.C612,A.G628,A.G629,A.G630,A.G631,A.A632,A.G633 nts=6 GAAAGA A.G606,A.A607,A.A608,A.A609,A.G610,A.A611 nts=4 GGGA A.G629,A.G630,A.G631,A.A632 6 asymmetric internal loop: nts=14; [6,4]; linked by [#21,#22] summary: [2] 6 4 [A.887 A.910 A.894 A.905] 3 4 nts=14 GGAGUACGUGAAAC A.G887,A.G888,A.A889,A.G890,A.U891,A.A892,A.C893,A.G894,A.U905,A.G906,A.A907,A.A908,A.A909,A.C910 nts=6 GAGUAC A.G888,A.A889,A.G890,A.U891,A.A892,A.C893 nts=4 GAAA A.G906,A.A907,A.A908,A.A909 7 asymmetric internal loop: nts=15; [4,7]; linked by [#12,#13] summary: [2] 4 7 [A.683 A.707 A.688 A.699] 6 2 k-turn:normal nts=15 GAGUAGCGCAGAUAC A.G683,A.A684,A.G685,A.U686,A.A687,A.G688,A.C699,A.G700,A.C701,A.A702,A.G703,A.A704,A.U705,A.A706,A.C707 nts=4 AGUA A.A684,A.G685,A.U686,A.A687 nts=7 GCAGAUA A.G700,A.C701,A.A702,A.G703,A.A704,A.U705,A.A706 **************************************************************************** List of 5 junctions 1 3-way junction: nts=9; [1,2,0]; linked by [#4,#5,#-2] summary: [3] 1 2 0 [A.586 A.755 A.588 A.651 A.654 A.754] 3 7 1 nts=9 CGGCUAGCG A.C586,A.G587,A.G588,A.C651,A.U652,A.A653,A.G654,A.C754,A.G755 nts=1 G A.G587 nts=2 UA A.U652,A.A653 nts=0 2 3-way junction: nts=14; [0,7,1]; linked by [#11,#-3,#14] summary: [3] 0 7 1 [A.672 A.734 A.673 A.717 A.725 A.732] 7 1 2 nts=14 UGCGCCGAUGGCAG A.U672,A.G673,A.C717,A.G718,A.C719,A.C720,A.G721,A.A722,A.U723,A.G724,A.G725,A.C732,A.A733,A.G734 nts=0 nts=7 GCCGAUG A.G718,A.C719,A.C720,A.G721,A.A722,A.U723,A.G724 nts=1 A A.A733 3 3-way junction: nts=16; [2,3,5]; linked by [#18,#19,#20] summary: [3] 2 3 5 [A.826 A.874 A.829 A.857 A.861 A.868] 6 10 2 nts=16 CUAGCGAAGCGUUAAG A.C826,A.U827,A.A828,A.G829,A.C857,A.G858,A.A859,A.A860,A.G861,A.C868,A.G869,A.U870,A.U871,A.A872,A.A873,A.G874 nts=2 UA A.U827,A.A828 nts=3 GAA A.G858,A.A859,A.A860 nts=5 GUUAA A.G869,A.U870,A.U871,A.A872,A.A873 4 4-way junction: nts=23; [1,4,10,0]; linked by [#-1,#3,#15,#18] summary: [4] 1 4 10 0 [A.575 A.880 A.577 A.764 A.769 A.810 A.821 A.879] 1 4 6 6 nts=23 GGGCGAAAGCCCUAAACGAUGCC A.G575,A.G576,A.G577,A.C764,A.G765,A.A766,A.A767,A.A768,A.G769,A.C810,A.C811,A.C812,A.U813,A.A814,A.A815,A.A816,A.C817,A.G818,A.A819,A.U820,A.G821,A.C879,A.C880 nts=1 G A.G576 nts=4 GAAA A.G765,A.A766,A.A767,A.A768 nts=10 CCUAAACGAU A.C811,A.C812,A.U813,A.A814,A.A815,A.A816,A.C817,A.G818,A.A819,A.U820 nts=0 5* 5-way junction: nts=15; [0,0,2,3,0]; linked by [#1,#2,#20,#2,#-1] summary: [5] 0 0 2 3 0 [A.569 A.881 A.570 A.866 A.867 A.862 A.865 A.571 A.575 A.880] 3 2 2 2 1 nts=15 CGCGCUAAUAAAGCG A.C569,A.G570,A.C866,A.G867,A.C862,A.U863,A.A864,A.A865,A.U571,A.A572,A.A573,A.A574,A.G575,A.C880,A.G881 nts=0 nts=0 nts=2 UA A.U863,A.A864 nts=3 AAA A.A572,A.A573,A.A574 nts=0 **************************************************************************** List of 3 non-loop single-stranded segments 1 nts=5 CACUG A.C562,A.A563,A.C564,A.U565,A.G566 2 nts=1 U A.U884 3 nts=1 A A.A913 **************************************************************************** List of 11 A-minor motifs (types I, II, or X) 1 type=II A|G-C A.A573|A.G567,A.C883 WC +A.G567 H-bonds[0]: "" -A.C883 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.92],N3-O2'(hydroxyl)[2.72]" 2 type=I A|G-C A.A574|A.G568,A.C882 WC +A.G568 H-bonds[2]: "N1-O2'(hydroxyl)[2.62],N3-N2(amino)[2.85]" -A.C882 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[2.58],O2'(hydroxyl)-O2(carbonyl)[2.97]" 3 type=X A|U-A A.A642|A.U598,A.A640 WC -A.U598 H-bonds[1]: "N6(amino)-O2(carbonyl)[3.02]" +A.A640 H-bonds[0]: "" 4 type=X A|G-C A.A695|A.G786,A.C796 WC -A.G786 H-bonds[1]: "N1-N2(amino)[3.27]" +A.C796 H-bonds[0]: "" 5 type=X A|G-C A.A696|A.G785,A.C797 WC -A.G785 H-bonds[0]: "" +A.C797 H-bonds[2]: "N6(amino)-O2'(hydroxyl)[2.96],N1-O2'(hydroxyl)[2.64]" 6 type=I A|G-C A.A704|A.G688,A.C699 WC +A.G688 H-bonds[2]: "N1-O2'(hydroxyl)[2.60],N3-N2(amino)[3.02]" -A.C699 H-bonds[0]: "" 7 type=II A|C-G A.A728|A.C578,A.G763 WC -A.C578 H-bonds[3]: "O2'(hydroxyl)-O3'[2.95],O2'(hydroxyl)-O2'(hydroxyl)[2.86],N3-O2'(hydroxyl)[2.53]" +A.G763 H-bonds[0]: "" 8 type=I A|G-C A.A729|A.G577,A.C764 WC -A.G577 H-bonds[2]: "O2'(hydroxyl)-O2'(hydroxyl)[3.16],N3-N2(amino)[3.05]" +A.C764 H-bonds[1]: "N1-O2'(hydroxyl)[2.78]" 9 type=X A|A-G A.A777|A.A676,A.G714 Imino +A.A676 H-bonds[0]: "" -A.G714 H-bonds[1]: "N3-N2(amino)[2.94]" 10 type=I A|C-G A.A873|A.C862,A.G867 WC -A.C862 H-bonds[0]: "" +A.G867 H-bonds[2]: "N1-O2'(hydroxyl)[2.76],N3-N2(amino)[3.55]" 11 type=X A|G-C A.A900|A.G769,A.C810 WC -A.G769 H-bonds[1]: "N1-N2(amino)[2.88]" +A.C810 H-bonds[0]: "" **************************************************************************** List of 3 ribose zippers 1 nts=4 AACC A.A573,A.A574,A.C882,A.C883 2 nts=4 GCAA A.G577,A.C578,A.A728,A.A729 3 nts=4 AUGG A.A696,A.U697,A.G785,A.G786 **************************************************************************** List of 1 possible kink turn 1 Normal k-turn; iloop#7; between stems [#13,#12]; bending-angle=56 C#13[CG A.C699,A.G688] [GA A.G703,A.A687] NC#12[CG A.C707,A.G683] strand1 nts=15; GCGCAGAUACCGGGA A.G698,A.C699,A.G700,A.C701,A.A702,A.G703,A.A704,A.U705,A.A706,A.C707,A.C708,A.G709,A.G710,A.G711,A.A712 strand2 nts=12; UCCCGGAGUAGC A.U678,A.C679,A.C680,A.C681,A.G682,A.G683,A.A684,A.G685,A.U686,A.A687,A.G688,A.C689 **************************************************************************** List of 34 splayed-apart dinucleotides 1 A.A563 A.C564 angle=118 distance=15.1 ratio=0.86 2 A.G566 A.G567 angle=88 distance=13.6 ratio=0.69 3 A.C569 A.G570 angle=170 distance=18.1 ratio=1.00 4 A.G606 A.A607 angle=166 distance=18.2 ratio=0.99 5 A.C618 A.U619 angle=97 distance=13.9 ratio=0.75 6 A.G664 A.A665 angle=107 distance=16.2 ratio=0.80 7 A.A665 A.G666 angle=138 distance=17.2 ratio=0.93 8 A.C701 A.A702 angle=168 distance=19.3 ratio=0.99 9 A.A702 A.G703 angle=118 distance=16.3 ratio=0.86 10 A.A722 A.U723 angle=87 distance=11.4 ratio=0.69 11 A.U723 A.G724 angle=100 distance=13.4 ratio=0.77 12 A.A733 A.G734 angle=152 distance=17.9 ratio=0.97 13 A.C754 A.G755 angle=100 distance=12.7 ratio=0.76 14 A.G765 A.A766 angle=89 distance=13.4 ratio=0.70 15 A.G776 A.A777 angle=86 distance=12.6 ratio=0.68 16 A.A792 A.U793 angle=93 distance=14.7 ratio=0.73 17 A.U793 A.A794 angle=107 distance=16.7 ratio=0.80 18 A.A814 A.A815 angle=101 distance=15.9 ratio=0.77 19 A.A815 A.A816 angle=143 distance=19.7 ratio=0.95 20 A.A816 A.C817 angle=117 distance=15.9 ratio=0.85 21 A.C817 A.G818 angle=105 distance=15.7 ratio=0.79 22 A.G818 A.A819 angle=127 distance=17.5 ratio=0.90 23 A.A819 A.U820 angle=89 distance=14.0 ratio=0.70 24 A.U820 A.G821 angle=137 distance=17.2 ratio=0.93 25 A.U839 A.C840 angle=103 distance=13.4 ratio=0.79 26 A.C840 A.U841 angle=172 distance=20.3 ratio=1.00 27 A.U841 A.C848 angle=121 distance=15.2 ratio=0.87 28 A.G869 A.U870 angle=108 distance=15.3 ratio=0.81 29 A.U870 A.U871 angle=158 distance=19.3 ratio=0.98 30 A.U871 A.A872 angle=126 distance=16.3 ratio=0.89 31 A.A872 A.A873 angle=104 distance=15.1 ratio=0.79 32 A.A873 A.G874 angle=125 distance=16.8 ratio=0.89 33 A.U884 A.G885 angle=160 distance=18.7 ratio=0.99 34 A.G898 A.C899 angle=88 distance=12.1 ratio=0.70 ---------------------------------------------------------------- Summary of 18 splayed-apart units 1 nts=2 AC A.A563,A.C564 2 nts=2 GG A.G566,A.G567 3 nts=2 CG A.C569,A.G570 4 nts=2 GA A.G606,A.A607 5 nts=2 CU A.C618,A.U619 6 nts=3 GAG A.G664,A.A665,A.G666 7 nts=3 CAG A.C701,A.A702,A.G703 8 nts=3 AUG A.A722,A.U723,A.G724 9 nts=2 AG A.A733,A.G734 10 nts=2 CG A.C754,A.G755 11 nts=2 GA A.G765,A.A766 12 nts=2 GA A.G776,A.A777 13 nts=3 AUA A.A792,A.U793,A.A794 14 nts=8 AAACGAUG A.A814,A.A815,A.A816,A.C817,A.G818,A.A819,A.U820,A.G821 15 nts=4 UCUC A.U839,A.C840,A.U841,A.C848 16 nts=6 GUUAAG A.G869,A.U870,A.U871,A.A872,A.A873,A.G874 17 nts=2 UG A.U884,A.G885 18 nts=2 GC A.G898,A.C899 **************************************************************************** This structure contains 1-order pseudoknot o You may want to run DSSR again with the '--nested' option which removes pseudoknots to get a fully nested secondary structure representation. **************************************************************************** Secondary structures in dot-bracket notation (dbn) as a whole and per chain >RNA nts=346 [whole] CACUGGGCGUAAAGGGCGUGUAGGCGGCCUGGGGCGUCCCAUGUGAAAGACCACGGCUCAACCGUGGGGGAGCGUGGGAUACGCUCAGGCUAGACGGUGGGAGAGGGUGGUGGAAUUCCCGGAGUAGCGGUGAAAUGCGCAGAUACCGGGAGGAACGCCGAUGGCGAAGGCAGCCACCUGGUCCACCCGUGACGCUGAGGCGCGAAAGCGUGGGGAGCAAACCGGAUUAGAUACCCGGGUAGUCCACGCCCUAAACGAUGCGCGCUAGGUCUCUGGGUCUCCUGGGGGCCGAAGCUAACGCGUUAAGCGCGCCGCCUGGGGAGUACGGCCGCAAGGCUGAAACUCA .....((([[...(.((((...(((.(((((((.((((((((((......((((((.....))))))....))))))))..)))))))))..(((((((((...((((((((....((((((....((........)).......))))))....).......((....)).)))))))..))))).)))..))))...))))....((((((...((...((((.........))))...))))))))..........((((((..((((((((((...))))))))))...((..]])).....)))))))))).(((......((((....))))....))). >RNA-A #1 nts=346 0.03(3.23) [chain] RNA CACUGGGCGUAAAGGGCGUGUAGGCGGCCUGGGGCGUCCCAUGUGAAAGACCACGGCUCAACCGUGGGGGAGCGUGGGAUACGCUCAGGCUAGACGGUGGGAGAGGGUGGUGGAAUUCCCGGAGUAGCGGUGAAAUGCGCAGAUACCGGGAGGAACGCCGAUGGCGAAGGCAGCCACCUGGUCCACCCGUGACGCUGAGGCGCGAAAGCGUGGGGAGCAAACCGGAUUAGAUACCCGGGUAGUCCACGCCCUAAACGAUGCGCGCUAGGUCUCUGGGUCUCCUGGGGGCCGAAGCUAACGCGUUAAGCGCGCCGCCUGGGGAGUACGGCCGCAAGGCUGAAACUCA .....((([[...(.((((...(((.(((((((.((((((((((......((((((.....))))))....))))))))..)))))))))..(((((((((...((((((((....((((((....((........)).......))))))....).......((....)).)))))))..))))).)))..))))...))))....((((((...((...((((.........))))...))))))))..........((((((..((((((((((...))))))))))...((..]])).....)))))))))).(((......((((....))))....))). **************************************************************************** Summary of structural features of 346 nucleotides Note: the first five columns are: (1) serial number, (2) one-letter shorthand name, (3) dbn, (4) id string, (5) rmsd (~zero) of base ring atoms fitted against those in a standard base reference frame. The sixth (last) column contains a comma-separated list of features whose meanings are mostly self-explanatory, except for: turn: angle C1'(i-1)--C1'(i)--C1'(i+1) < 90 degrees break: no backbone linkage between O3'(i-1) and P(i) 1 C . A.C562 0.006 anti,~C2'-endo,non-pair-contact,ss-non-loop 2 A . A.A563 0.009 ~C3'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,splayed-apart 3 C . A.C564 0.004 turn,anti,~C3'-endo,BI,non-pair-contact,ss-non-loop,phosphate,splayed-apart 4 U . A.U565 0.013 anti,~C3'-endo,non-pair-contact,ss-non-loop,phosphate 5 G . A.G566 0.008 anti,~C2'-endo,BII,non-pair-contact,ss-non-loop,splayed-apart 6 G ( A.G567 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor,splayed-apart 7 G ( A.G568 0.005 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor 8 C ( A.C569 0.006 anti,~C3'-endo,BII,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor,splayed-apart 9 G [ A.G570 0.011 pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,multiplet,junction-loop,cap-donor,splayed-apart 10 U [ A.U571 0.007 pseudoknotted,anti,~C3'-endo,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 11 A . A.A572 0.014 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop 12 A . A.A573 0.019 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,ribose-zipper 13 A . A.A574 0.017 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,A-minor,ribose-zipper,cap-acceptor 14 G ( A.G575 0.021 anti,~C2'-endo,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,junction-loop 15 G . A.G576 0.012 anti,~C2'-endo,non-stack,non-canonical,non-pair-contact,multiplet,junction-loop,cap-acceptor,phosphate 16 G ( A.G577 0.013 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,ribose-zipper,cap-donor 17 C ( A.C578 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,ribose-zipper,phosphate 18 G ( A.G579 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 19 U ( A.U580 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 20 G . A.G581 0.015 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 21 U . A.U582 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 22 A . A.A583 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 23 G ( A.G584 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 24 G ( A.G585 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 25 C ( A.C586 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop 26 G . A.G587 0.014 anti,~C2'-endo,non-pair-contact,junction-loop 27 G ( A.G588 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 28 C ( A.C589 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 29 C ( A.C590 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 30 U ( A.U591 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 31 G ( A.G592 0.017 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 32 G ( A.G593 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 33 G ( A.G594 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 34 G . A.G595 0.011 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,bulge 35 C ( A.C596 0.015 anti,~C3'-endo,BI,non-stack,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 36 G ( A.G597 0.018 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,cap-acceptor 37 U ( A.U598 0.007 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,bulge,A-minor,cap-donor 38 C ( A.C599 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 39 C ( A.C600 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 40 C ( A.C601 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 41 A ( A.A602 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 42 U ( A.U603 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 43 G ( A.G604 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 44 U ( A.U605 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 45 G . A.G606 0.003 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,splayed-apart 46 A . A.A607 0.005 anti,~C3'-endo,BI,non-pair-contact,internal-loop,phosphate,splayed-apart 47 A . A.A608 0.008 anti,~C3'-endo,BI,non-pair-contact,internal-loop 48 A . A.A609 0.011 anti,~C3'-endo,BI,non-pair-contact,internal-loop 49 G . A.G610 0.011 anti,~C3'-endo,BI,non-pair-contact,internal-loop 50 A . A.A611 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 51 C ( A.C612 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 52 C ( A.C613 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 53 A ( A.A614 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 54 C ( A.C615 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 55 G ( A.G616 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 56 G ( A.G617 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 57 C . A.C618 0.013 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,splayed-apart 58 U . A.U619 0.008 turn,anti,~C3'-endo,BI,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 59 C . A.C620 0.008 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 60 A . A.A621 0.003 anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,phosphate 61 A . A.A622 0.010 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 62 C ) A.C623 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 63 C ) A.C624 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 64 G ) A.G625 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 65 U ) A.U626 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 66 G ) A.G627 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 67 G ) A.G628 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 68 G . A.G629 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 69 G . A.G630 0.005 anti,~C3'-endo,BI,non-pair-contact,internal-loop 70 G . A.G631 0.005 anti,~C3'-endo,non-pair-contact,internal-loop 71 A . A.A632 0.004 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop 72 G ) A.G633 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop 73 C ) A.C634 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 74 G ) A.G635 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 75 U ) A.U636 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 76 G ) A.G637 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 77 G ) A.G638 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 78 G ) A.G639 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 79 A ) A.A640 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,multiplet,bulge,A-minor 80 U . A.U641 0.009 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,bulge 81 A . A.A642 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,multiplet,bulge,A-minor 82 C ) A.C643 0.004 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 83 G ) A.G644 0.018 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 84 C ) A.C645 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 85 U ) A.U646 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 86 C ) A.C647 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 87 A ) A.A648 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 88 G ) A.G649 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 89 G ) A.G650 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 90 C ) A.C651 0.002 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 91 U . A.U652 0.009 anti,~C2'-endo,non-canonical,non-pair-contact,helix,junction-loop 92 A . A.A653 0.005 turn,syn,~C2'-endo,non-stack,non-pair-contact,junction-loop,phosphate 93 G ( A.G654 0.013 anti,~C3'-endo,BI,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,junction-loop 94 A ( A.A655 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 95 C ( A.C656 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 96 G ( A.G657 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge 97 G ( A.G658 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 98 U ( A.U659 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 99 G ( A.G660 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 100 G ( A.G661 0.005 anti,~C3'-endo,canonical,non-pair-contact,helix,stem,coaxial-stack 101 G ( A.G662 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 102 A . A.A663 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 103 G . A.G664 0.015 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart 104 A . A.A665 0.006 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,splayed-apart 105 G ( A.G666 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop,phosphate,splayed-apart 106 G ( A.G667 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 107 G ( A.G668 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 108 U ( A.U669 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 109 G ( A.G670 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 110 G ( A.G671 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 111 U ( A.U672 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 112 G ( A.G673 0.007 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,internal-loop,junction-loop 113 G . A.G674 0.016 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 114 A . A.A675 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 115 A . A.A676 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor 116 U . A.U677 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 117 U ( A.U678 0.014 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 118 C ( A.C679 0.006 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 119 C ( A.C680 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 120 C ( A.C681 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 121 G ( A.G682 0.009 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 122 G ( A.G683 0.004 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 123 A . A.A684 0.008 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 124 G . A.G685 0.005 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop 125 U . A.U686 0.004 k-turn,anti,~C2'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 126 A . A.A687 0.007 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,phosphate 127 G ( A.G688 0.012 k-turn,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,internal-loop,A-minor,phosphate 128 C ( A.C689 0.007 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 129 G . A.G690 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop 130 G . A.G691 0.021 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 131 U . A.U692 0.007 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 132 G . A.G693 0.011 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 133 A . A.A694 0.010 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 134 A . A.A695 0.008 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,phosphate 135 A . A.A696 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,A-minor,ribose-zipper,phosphate 136 U . A.U697 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,hairpin-loop,ribose-zipper 137 G ) A.G698 0.010 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 138 C ) A.C699 0.012 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,multiplet,internal-loop,A-minor 139 G . A.G700 0.009 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,internal-loop 140 C . A.C701 0.005 turn,k-turn,anti,non-pair-contact,internal-loop,cap-donor,phosphate,splayed-apart 141 A . A.A702 0.011 turn,k-turn,anti,~C2'-endo,non-stack,non-pair-contact,internal-loop,phosphate,splayed-apart 142 G . A.G703 0.005 k-turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,multiplet,internal-loop,cap-acceptor,splayed-apart 143 A . A.A704 0.006 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor,phosphate 144 U . A.U705 0.011 k-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 145 A . A.A706 0.011 k-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 146 C ) A.C707 0.009 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 147 C ) A.C708 0.003 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 148 G ) A.G709 0.011 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 149 G ) A.G710 0.005 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 150 G ) A.G711 0.008 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 151 A ) A.A712 0.009 k-turn,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 152 G . A.G713 0.012 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 153 G . A.G714 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,A-minor 154 A . A.A715 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 155 A . A.A716 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 156 C ) A.C717 0.007 anti,~C2'-endo,BII,isolated-canonical,non-pair-contact,helix,internal-loop,junction-loop 157 G . A.G718 0.008 anti,~C3'-endo,non-pair-contact,junction-loop,phosphate 158 C . A.C719 0.008 anti,~C3'-endo,non-pair-contact,junction-loop,phosphate 159 C . A.C720 0.004 anti,~C3'-endo,non-pair-contact,junction-loop,phosphate 160 G . A.G721 0.005 anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor 161 A . A.A722 0.012 syn,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,cap-donor,cap-acceptor,splayed-apart 162 U . A.U723 0.011 turn,anti,~C3'-endo,non-stack,junction-loop,cap-acceptor,splayed-apart 163 G . A.G724 0.013 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 164 G ( A.G725 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop,phosphate 165 C ( A.C726 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop 166 G . A.G727 0.029 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 167 A . A.A728 0.008 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,A-minor,ribose-zipper,phosphate 168 A . A.A729 0.016 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,ribose-zipper,cap-donor,phosphate 169 G . A.G730 0.011 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 170 G ) A.G731 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,cap-donor,phosphate 171 C ) A.C732 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,junction-loop 172 A . A.A733 0.011 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,junction-loop,splayed-apart 173 G ) A.G734 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 174 C ) A.C735 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 175 C ) A.C736 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 176 A ) A.A737 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 177 C ) A.C738 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 178 C ) A.C739 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 179 U ) A.U740 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 180 G . A.G741 0.016 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 181 G . A.G742 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 182 U ) A.U743 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 183 C ) A.C744 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 184 C ) A.C745 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 185 A ) A.A746 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 186 C ) A.C747 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge,phosphate 187 C . A.C748 0.007 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,bulge 188 C ) A.C749 0.012 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,phosphate 189 G ) A.G750 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 190 U ) A.U751 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 191 G . A.G752 0.015 anti,~C2'-endo,BII,non-canonical,non-pair-contact,multiplet,bulge 192 A . A.A753 0.008 turn,anti,~C2'-endo,non-canonical,non-pair-contact,helix,bulge,phosphate 193 C ) A.C754 0.007 turn,syn,~C3'-endo,non-stack,isolated-canonical,non-canonical,non-pair-contact,helix,multiplet,bulge,junction-loop,phosphate,splayed-apart 194 G ) A.G755 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,junction-loop,splayed-apart 195 C ) A.C756 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem 196 U ) A.U757 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,internal-loop,phosphate 197 G . A.G758 0.015 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 198 A . A.A759 0.008 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,internal-loop,phosphate 199 G . A.G760 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 200 G ) A.G761 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 201 C ) A.C762 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 202 G ) A.G763 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 203 C ) A.C764 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 204 G . A.G765 0.012 anti,~C3'-endo,BII,non-canonical,non-pair-contact,helix,junction-loop,splayed-apart 205 A . A.A766 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate,splayed-apart 206 A . A.A767 0.011 anti,~C3'-endo,BI,non-pair-contact,junction-loop 207 A . A.A768 0.017 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 208 G ( A.G769 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor,phosphate 209 C ( A.C770 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 210 G ( A.G771 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 211 U ( A.U772 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 212 G ( A.G773 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 213 G ( A.G774 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 214 G . A.G775 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,bulge 215 G . A.G776 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,multiplet,bulge,splayed-apart 216 A . A.A777 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,bulge,A-minor,splayed-apart 217 G ( A.G778 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,phosphate 218 C ( A.C779 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 219 A . A.A780 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop 220 A . A.A781 0.011 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 221 A . A.A782 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 222 C ( A.C783 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 223 C ( A.C784 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 224 G ( A.G785 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor,ribose-zipper 225 G ( A.G786 0.010 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor,ribose-zipper 226 A . A.A787 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop 227 U . A.U788 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop 228 U . A.U789 0.014 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-acceptor 229 A . A.A790 0.004 turn,u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop 230 G . A.G791 0.008 u-turn,anti,~C3'-endo,BI,non-pair-contact,hairpin-loop,cap-donor,phosphate 231 A . A.A792 0.009 u-turn,anti,~C2'-endo,non-pair-contact,hairpin-loop,phosphate,splayed-apart 232 U . A.U793 0.007 turn,anti,~C2'-endo,non-stack,non-pair-contact,hairpin-loop,phosphate,splayed-apart 233 A . A.A794 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,hairpin-loop,phosphate,splayed-apart 234 C . A.C795 0.006 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,phosphate 235 C ) A.C796 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,hairpin-loop,A-minor 236 C ) A.C797 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,A-minor 237 G ) A.G798 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 238 G ) A.G799 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 239 G . A.G800 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 240 U . A.U801 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 241 A . A.A802 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 242 G ) A.G803 0.013 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,internal-loop 243 U ) A.U804 0.009 anti,~C3'-endo,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,bulge,phosphate 244 C ) A.C805 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,bulge 245 C ) A.C806 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 246 A ) A.A807 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 247 C ) A.C808 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 248 G ) A.G809 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet 249 C ) A.C810 0.008 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,junction-loop,A-minor 250 C . A.C811 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 251 C . A.C812 0.007 anti,~C3'-endo,non-pair-contact,junction-loop,phosphate 252 U . A.U813 0.010 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,phosphate 253 A . A.A814 0.019 anti,~C3'-endo,non-pair-contact,junction-loop,cap-acceptor,phosphate,splayed-apart 254 A . A.A815 0.018 turn,anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,splayed-apart 255 A . A.A816 0.007 turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix,junction-loop,cap-donor,cap-acceptor,phosphate,splayed-apart 256 C . A.C817 0.010 anti,~C2'-endo,non-pair-contact,junction-loop,cap-acceptor,splayed-apart 257 G . A.G818 0.011 turn,anti,~C2'-endo,non-pair-contact,junction-loop,cap-acceptor,splayed-apart 258 A . A.A819 0.005 turn,anti,~C2'-endo,non-pair-contact,junction-loop,cap-donor,splayed-apart 259 U . A.U820 0.008 anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,cap-donor,cap-acceptor,phosphate,splayed-apart 260 G ( A.G821 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate,splayed-apart 261 C ( A.C822 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 262 G ( A.G823 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 263 C ( A.C824 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 264 G ( A.G825 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 265 C ( A.C826 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 266 U . A.U827 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop 267 A . A.A828 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop,cap-acceptor 268 G ( A.G829 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 269 G ( A.G830 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 270 U ( A.U831 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 271 C ( A.C832 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 272 U ( A.U833 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 273 C ( A.C834 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 274 U ( A.U835 0.014 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 275 G ( A.G836 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 276 G ( A.G837 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 277 G ( A.G838 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop 278 U . A.U839 0.010 turn,~C3'-endo,non-stack,hairpin-loop,splayed-apart 279 C . A.C840 0.008 anti,~C3'-endo,non-pair-contact,hairpin-loop,splayed-apart 280 U . A.U841 0.005 turn,anti,~C3'-endo,non-stack,hairpin-loop,splayed-apart 281 C ) A.C848 0.004 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,hairpin-loop,splayed-apart 282 C ) A.C849 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 283 U ) A.U850 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 284 G ) A.G851 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 285 G ) A.G852 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 286 G ) A.G853 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 287 G ) A.G854 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,cap-donor,phosphate 288 G ) A.G855 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,phosphate 289 C ) A.C856 0.005 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 290 C ) A.C857 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 291 G . A.G858 0.014 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,junction-loop 292 A . A.A859 0.005 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,junction-loop,cap-donor,phosphate 293 A . A.A860 0.014 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,junction-loop 294 G ( A.G861 0.009 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop 295 C ( A.C862 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,A-minor 296 U . A.U863 0.011 anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,junction-loop 297 A . A.A864 0.014 turn,anti,~C3'-endo,non-pair-contact,hairpin-loop,junction-loop 298 A ] A.A865 0.011 pseudoknotted,anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,hairpin-loop,junction-loop 299 C ] A.C866 0.007 pseudoknotted,anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,multiplet,hairpin-loop,junction-loop 300 G ) A.G867 0.009 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,multiplet,hairpin-loop,junction-loop,A-minor 301 C ) A.C868 0.010 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor 302 G . A.G869 0.018 anti,~C3'-endo,non-canonical,non-pair-contact,helix,multiplet,junction-loop,splayed-apart 303 U . A.U870 0.005 turn,anti,~C2'-endo,non-pair-contact,junction-loop,phosphate,splayed-apart 304 U . A.U871 0.011 turn,anti,~C2'-endo,non-stack,non-pair-contact,junction-loop,cap-acceptor,splayed-apart 305 A . A.A872 0.013 syn,~C2'-endo,BII,non-canonical,non-pair-contact,helix-end,multiplet,junction-loop,splayed-apart 306 A . A.A873 0.018 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,junction-loop,A-minor,cap-acceptor,phosphate,splayed-apart 307 G ) A.G874 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,splayed-apart 308 C ) A.C875 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 309 G ) A.G876 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 310 C ) A.C877 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 311 G ) A.G878 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 312 C ) A.C879 0.019 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,phosphate 313 C ) A.C880 0.012 anti,~C3'-endo,BI,isolated-canonical,non-pair-contact,helix,multiplet,junction-loop 314 G ) A.G881 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,junction-loop,cap-donor 315 C ) A.C882 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack,multiplet,A-minor,ribose-zipper 316 C ) A.C883 0.006 anti,~C3'-endo,BI,canonical,non-canonical,non-pair-contact,helix,stem-end,coaxial-stack,multiplet,A-minor,ribose-zipper 317 U . A.U884 0.014 anti,~C2'-endo,non-canonical,non-pair-contact,helix-end,ss-non-loop,splayed-apart 318 G ( A.G885 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack,splayed-apart 319 G ( A.G886 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 320 G ( A.G887 0.013 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 321 G . A.G888 0.009 anti,~C3'-endo,non-canonical,non-pair-contact,helix,internal-loop,phosphate 322 A . A.A889 0.008 anti,~C2'-endo,BII,non-canonical,non-pair-contact,helix,internal-loop 323 G . A.G890 0.007 turn,anti,~C2'-endo,non-canonical,non-pair-contact,multiplet,internal-loop 324 U . A.U891 0.006 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 325 A . A.A892 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 326 C . A.C893 0.004 anti,~C3'-endo,BI,non-pair-contact,internal-loop 327 G ( A.G894 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 328 G ( A.G895 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 329 C ( A.C896 0.011 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 330 C ( A.C897 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop 331 G . A.G898 0.026 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,splayed-apart 332 C . A.C899 0.006 turn,u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,splayed-apart 333 A . A.A900 0.011 u-turn,anti,~C3'-endo,BI,non-canonical,non-pair-contact,multiplet,hairpin-loop,A-minor,cap-donor,phosphate 334 A . A.A901 0.017 u-turn,anti,~C3'-endo,non-canonical,non-pair-contact,helix-end,hairpin-loop,cap-acceptor,phosphate 335 G ) A.G902 0.012 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,hairpin-loop,cap-donor 336 G ) A.G903 0.008 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 337 C ) A.C904 0.006 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 338 U ) A.U905 0.015 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 339 G . A.G906 0.008 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 340 A . A.A907 0.009 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,multiplet,internal-loop,phosphate 341 A . A.A908 0.003 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop,phosphate 342 A . A.A909 0.007 anti,~C3'-endo,BI,non-canonical,non-pair-contact,helix,internal-loop 343 C ) A.C910 0.007 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem-end,coaxial-stack,internal-loop 344 U ) A.U911 0.003 anti,~C3'-endo,BI,canonical,non-pair-contact,helix,stem,coaxial-stack 345 C ) A.C912 0.007 anti,~C3'-endo,canonical,non-pair-contact,helix-end,stem-end,coaxial-stack 346 A . A.A913 0.007 anti,~C3'-endo,non-pair-contact,ss-non-loop **************************************************************************** List of 17 additional files 1 dssr-pairs.pdb -- an ensemble of base pairs 2 dssr-multiplets.pdb -- an ensemble of multiplets 3 dssr-stems.pdb -- an ensemble of stems 4 dssr-helices.pdb -- an ensemble of helices (coaxial stacking) 5 dssr-hairpins.pdb -- an ensemble of hairpin loops 6 dssr-bulges.pdb -- an ensemble of bulges 7 dssr-iloops.pdb -- an ensemble of internal loops 8 dssr-junctions.pdb -- an ensemble of junctions (multi-branch) 9 dssr-2ndstrs.bpseq -- secondary structure in bpseq format 10 dssr-2ndstrs.ct -- secondary structure in connectivity table format 11 dssr-2ndstrs.dbn -- secondary structure in dot-bracket notation 12 dssr-torsions.txt -- backbone torsion angles and suite names 13 dssr-splays.pdb -- an ensemble of splayed-apart units 14 dssr-Aminors.pdb -- an ensemble of A minor motifs (types I and II) 15 dssr-Kturns.pdb -- an ensemble of kink-turn motifs 16 dssr-stacks.pdb -- an ensemble of base stacks 17 dssr-atom2bases.pdb -- an ensemble of atom-base stacking interactions **************************************************************************** Time used: 00:00:00:00